AccueilPortailCalendrierFAQRechercherMembresGroupesS'enregistrerConnexion

Partagez | 
 

 Halloween Night {Libre}

Voir le sujet précédent Voir le sujet suivant Aller en bas 
Aller à la page : 1, 2  Suivant
AuteurMessage
Echo
X-Men Oméga
avatar

Messages : 1011
Date d'inscription : 10/05/2012
Age : 23

MessageSujet: Halloween Night {Libre}   Lun 22 Déc - 16:03

Vendredi 31 Octobre 2014 – 08 : 00 P.M.
Instant Crush by Daft punk on Grooveshark

La musique raisonnait déjà alors que l’heure était atteinte. Tout était prêt à temps et cela avait été sportif malgré les trois jours d’avance qu’elle avait prise pour faire les préparatifs. Rien que pour la préparation de la nourriture avait prise l’après-midi et elle n’y serait jamais arrivée seule ; mais elle ne l’était pas, seule, et de nombreuses petites mains lui avaient porté secours. Cela gâchait un peu la surprise mais de toute façon elle avait non seulement dû mettre un certain nombre de personne au courant, pour l’autorisation et l’organisation, tandis que d’autres l’avaient été, parce qu’elles avaient posées des questions aux bonnes personnes ou simplement eu le sens du détail, mais en plus ce n’était pas réellement une surprise puisque tous connaissaient la date de cette fête.

Halloween était plus ou moins la seule fête à laquelle Rachel tenait, elle ne fêtait pas son anniversaire pour des raisons compliquées et était indifférente aux autres pour des raisons simples, néanmoins la veillée de la toussaint, la toussaint puis la fête des morts étaient importantes à ses yeux. Un moyen de continuer à vivre et de rendre hommage à ceux qu’elle avait perdus avec plus de joie et de gaité que d’ordinaire. Mais de là à demander à organiser une soirée Halloween à l’Institution, considérant la grande gamine légèrement bordélique et simplette qu’elle était, s’en surprendraient quelques uns. Suite aux événements de Bleecker Street, il n’avait plus tellement été question de fêtes étudiantes ou autres instants de légèreté pourtant c’étaient eux qui pouvaient redonner goût en la vie ; quoi de mieux qu’une soirée déguisée pour la fête de morts afin de montrer cela ? Rendre hommage aux morts par la joie des vivants, le principe était aussi ancestral que facile à oublier.

Elle ne se faisait pas d’idées : tous ne seraient pas ici, quelques soient leurs raisons, mais si elle arrivait à faire à nouveau sourire certaines des personnes qui y seraient, cela lui allait. Et puis ce serait l’occasion de se mêler à elles, d’oublier voir de casser l’image problématique que certains lui dessinaient, de participer et de s’intégrer un peu plus, malgré ses bizarreries. Mains croisées derrière le bassin, elle regardait les résidents arriver par groupes qu’elle avait déjà pu observer mais auxquels elle n’avait pas forcément adressée la parole, plus que le nécessaire du moins, perchée sur des bottes à talons noires dont les semelles devaient bien rajouter à son mètre soixante-quatorze une demi-douzaine de centimètre et qui lui remontaient jusqu’aux genoux, entrant en contact avec l’arrière d’une redingote sans manche d’un bleu si sombre qu’il en semblait noir à l’extérieur et blanche à l’intérieur et aux rebords percés de boutons dorés. Ces couleurs se retrouvaient sur le reste de la tenue : le blanc sur la culotte blanche ceinturée verticalement par six autres boutons, sur les gants, eux aussi agrémentés de boutons, et sur le soutien-gorge comme le jabot qui le couvrait ainsi que son collier en croix cerclée doré également ; le noir sur les brassards boutonnés, sur le nœud qui maintenant ses cheveux tressés et sur le grand tricorne qu’elle portait sur la tête, lui-même agrémenté d’une fleur en ruban blanc et bleu à l’égal de celui qui lui enserrait en diagonale le buste. Enfin, le doré des boutons se retrouvait sur les épaulières honorifiques. La tenue était sans doute si adaptée que personne n’y reconnaitrait l’inspiration première, pourtant le premier père de la nation ; rien n’était dû au hasard, il y avait un parallèle à faire entre ce personnage historique et ce qu’elle-même pourrait faire, pour rappeler que derrière la mémoire voir la légende il y avait des personnes, des personnes peut-être pas « comme les autres » mais des personnes tout de même.

Elle n’était pas des plus aisées dans les grandes foules mais c’était plus une oppression qu’une réelle peur et plus que savoir qu’elle pourrait s’isoler au besoin, elle espérait que les dimensions du gymnase éviteraient le sentiment de foule. La grande salle de la taille d’un terrain de football avait été nettoyée et décorée, les gradins longeant l’une des longueurs ayant été ornementés de têtes de citrouilles et tapissées de fausses toiles d’araignée tandis qu’à leur opposé se trouvait un certain nombre de tables accueillant le buffet, préparé l’après-midi même, et que les divers coins avaient acquits de nouvelles fonctions. Celui avec les tapis de sol s’en était vu délester pour que le centre de la salle devienne une piste de danse recouvrant une partie des marquages au sol, celui avec les punching-balls c’était vu doté d’une table de mixage improvisée, celui des murs d’escalade avait fait chier le monde et avait fini simplement décoré par des pendentifs accrochés aux prises colorées, et le dernier avait été laissé tel quel, les cagibis contenant le matériel de gymnastique toujours fermés et obstrués par les réserves de boisson. Boissons qui avaient été problématiques d’ailleurs, tant par la quantité à faire que par la grande question de l’alcool ; il ne fallait pas s’illusionner, l’Institution Charles Xavier était plus une école supérieure privée qu’une école secondaire ainsi qu’il en soit proposé ou que les élèves en amènent, il y aurait de l’alcool, restait à éviter qu’il ne tombe entre les mains des plus jeunes et qu’il y ait des conneries avec les cuités. Aucune boisson alcoolisée ne serait proposée par l’Institution et les encadrants avaient parfaitement le droit de punir tout comportement qu’ils jugeraient déviant ; ce qui impliquait que ce ne soient pas les encadrants qui se cuitent. Chose n’étant absolument pas l’intention de l’Echo, qui plus que préférer éviter d’embrasser qui que ce soit comme de finir dans sa gerbe les vingt-quatre heures suivantes considérait que la moindre des choses lorsqu’on organisait et encadrait une fête était de s’en souvenir. En tout cas plus que saluer ceux qui arrivaient, elle leur faisait parvenir les notes d’intention de la soirée : s’amuser gentiment. Elle n’avait pas envie de faire le gendarme mais avait déjà prouvée sa capacité à mettre en pause son amusement pour le faire avant de le reprendre comme si de rien était.

Des salutations accompagnées de sourires et parfois de remerciements, elle tâchait d’être une hôtesse d’accueil aussi naturelle que possible tout en attendant quelques personnes précises. La soirée n’était qu’à son commencement et elle espérait qu’elle se passe bien, pour eux tous.
And Rachel’s:
 

Hors Jeu:
 

_________________
Phénix

"Des monstres ont fait de moi un monstre,
Des divinités ont fait de moi une divinité,
Seuls les humains peuvent faire de moi une humaine."






731 Posts Rp
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Ninon Lenoir
Élève à l'Institut Beta
avatar

Messages : 243
Date d'inscription : 09/07/2014
Age : 24

MessageSujet: Re: Halloween Night {Libre}   Ven 26 Déc - 17:10

La quête pour s’occuper et s’empêcher de penser suivait son cour, tranquillement…
Et pourtant, marre de faire des cookies ! Marre, marre, marre ! Il fallait faire autre chose pour éviter de fermer les yeux !
Des muffins ?
Allez, en avant cocotte !
Depuis une semaine, tous les cookies de l’institut avaient été progressivement remplacés par des muffins victimes de leur succès ! A croire que la nouvelle gourmandise avait bien plus de prétendants que l’ancienne, pourtant ce n’était pas si mauvais les cookies…
Oui, ce n’était peut être pas si mauvais, mais à force d’en faire pendant un mois, maintenant, rien que leur nom suffisait à faire pâlir la cuisinière qui avait préféré laisser tomber le biscuit pour se recycler dans le monde fantastique du gâteau ! Et pourtant, aussi étrange que cela pouvait paraître, elle n’avait jamais touché à aucune de ses créations, préférant toutes les offrir plutôt que d’y goutter elle-même… Mais c’était comme tout, à force de faire quelque chose et de renifler chaque jour un peu plus l’odeur du beurre et du sucre, elle avait fini par en être écœurée…
Mais la pâte à muffins étant différentes, elle avait sonné comme un renouveau dans la cuisine et avait redonné à Ninon tout son enthousiasme qui s’évertuait à multiplier les saveurs et les couleurs !
Lundi, chocolat, un grand classique.
Mardi, caramel au beurre salé, fichus bretons qui venaient envahir insidieusement l’institut …
Mercredi, pomme ! Parce qu’il faudra toujours des normand pour enquiquiner les bretons !
Jeudi, cramberries, la journée sera rouge mes agneaux!
Vendredi, salé, parce qu’il fallait peut-être mieux éviter de froisser le public carnivore qui réclamait leur spécialité même si elle incluait que Ninon se retrouve en tête à tête avec un paquet de lardons…
Samedi, chocolat, again !
Et dimanche … Et bien dimanche rien… Alors oui, ça allait brailler dans l’institut qu’il n’y avait plus de muffins, mais que voulez vous, il fallait savoir se faire désirer pour créer une sensation de manque ! Sans compter qu’il était essentiel de laisser le temps au diabète des résidents de l’institut de redescendre un peu avant d’attaquer la semaine suivante… C’était d’ailleurs étonnant que l’infirmerie soit encore vide… A croire que le gène X rendait les élèves encore plus coriaces en plus des les rendre bleus… rouges… violets… Peu importe…
En parlant de couleur, pourquoi ne pas essayer de SpaceCake ? … Erf, mauvaise idée mes aïeux … mauvaise idée…
Bref, le dimanche, c’était le jour du Seigneur et le Seigneur avait dit « Ninon, dégage de la cuisine mon ptit trognon et trouves toi autre chose à faire ! ».
Alors Ninon était partie, la queue entre les jambes et la tête basse, à la recherche d’une nouvelle occupation, et quelle occupation !  La rumeur courrait qu’une soirée d’Halloween aurait lieu à la fin du mois, vendredi prochain quoi… Un vague de Sylvie Vartan monta en elle et elle eut une folle envie de chanter dans les couloirs « Ce soir je serai la plus beEeEeelleuh pour aller danseeEeeEerRr ! »
Sauf que Ninon ne chantait jamais en public ! Elle avait beau avoir des problème d’attention et de contrôle verbale depuis Bleecker, le chant ne faisait pas encore partie de ses activités publiques…
Dooonnc ! Elle ne chanterait pas de S.Vartan parce que voila, et puis Halloween ce n’était pas fait pour être jolie ! … A la réflexion faite, Halloween était plutôt la fête des morts…
Mm….
Erf….
Mouerf …
Faire une soirée sur la fête des morts n’était peut-être pas l’idée la plus lumineuse du moment, surtout après les récents événements… Et puis quelque chose clochait, elle n’aurait personne pour danser…
Comment ça personne ? Mais Ninon, pourquoi ne pas demander à Jade voyons ? Ta petite Souricette…  
Souricette ? Mais oui pourquoi pas, allons demander à Souricette… Souricette où es-tu ? Où te caches-tu ? Ah mais oui… Nous avions presque oublié un minuscule détail : Souricette n’était même pas là…
Nope !
Mademoiselle gros QI avait préféré faire son sac et partir dans le fin fond de l’Amérique pour une pseudo quête scientifico-spirituelle en n’emportant avec elle que son petit baluchon d’aventure ! Elle avait du partir un après midi… Et Pupuce n’avait pas tardé à la suivre, sauf que Pupuce, elle, elle en était morte…
Sisisi ! Pupuce s’était carapatée à tire d’ailes par la fenêtre aux environs de deux heures du matin, très légèrement aidée par Ninon.
Oh allez, tout de suite vous allez penser qu’elle l’avait balancée du haut du troisième étage !

Oui, elle l’avait fait, et alors ? La pâquerette était devenue neurasthénique et avait émis le souhait de reprendre son indépendance. Et bien il fallait savoir ce que l’on voulait dans la vie.
Indépendance ACCORDEE ! Boujoux pis bon voyage !
De toutes façon elle avait été prévenue, elle ferait moins la maline une fois dehors, et pour le coup, il était clair qu’elle n’avait pas gloussé longtemps. A peine trois secondes, juste le temps que Ninon l’attrape, ouvre la fenêtre et la jette de toutes ses forces dans la nuit noir.
Comptez jusqu’à trois.
…1
…2
…3
Et hop ! Disparue dans un grand PLAF de poterie brisée et de terreau éparpillé une dizaine de mètres plus bas ! Non non, ne vous inquiétez pas, elle n’avait pas souffert, elle était morte sur le coup… Et fort heureusement elle avait été la seule à mourir sur le coup puisque personne ne s’était trouvé en dessous… En même temps, au beau milieu de la nuit, les ballades se faisaient rares.
Bon, il allait aussi sans dire que le lendemain matin, Ninon était partie ramasser son cadavre en pleurant pour lui offrir des funérailles dignes de ce nom, dans le potager, pas loin du pauvre chou sur lequel elle avait marché…. Quand on y repensait, c’était un tantinet tragique de se rendre compte que les dépouilles de ses victimes commençaient à s’y entasser… Pas étonnant que les fraises aient du mal à pousser si on ne leur offrait à manger que des cadavres ! … Et puis si c’était pour finir de la même manière, autant rester au stade où elles étaient…
Donc, oui, la fête des morts ! Pas simple d’essayer de se canaliser et de classer les idées ! Mais ça s’arrangeait, mine de rien… Un peu… Si si, déconnez pas, il y avait du progrès !
Pas de Pupuce, ni de Jade pour l’accompagner et pourtant, sortir n’était peut-être pas une si mauvaise idée ! Et puis la création d’un costume était un excellent moyen de s’occuper les mains et l’esprit.
Par contre, pas de machine, pas de costume… Et le plus ballot dans cette histoire était que les machines à coudre ne poussaient pas dans les jardins… Même avec les cadavres… Enfin pas à sa connaissance, sauf si en plus du chou et de Pupuce se trouvaient un gang de chinois implantés sous le potager…
Mais il y avait des choses auxquelles il valait mieux ne pas penser parce qu’avec l’état psychologique fragile et paranoïaque dans lequel elle se trouvait, Ninon aurait été parfaitement capable de retourner tout le parc de l’institut à la recherche d’un atelier clandestin… Il y avait des choses avec lesquelles on ne rigolait pas !
Non, le plus simple pour avoir une machine n’était pas d’attendre de la voir apparaître entre deux feuilles et une motte de terre… Le plus simple était d’aller en demander une aux autorités conséquentes. La vie scolaire l’avait regardée avec des grands yeux (Cimer Darla ! Charmante, comme d’habitude, change rien ma grande !), même si on lui avait simplement demandé de repasser en fin d’après-midi. Ce qu’elle avait fait et quelques heures plus tard, elle s’était retrouvée avec une machine à coudre pour mettre en place son chef d’œuvre. Comme quoi, ça aidait parfois d’être dans un institut financé par trois des plus grandes fortunes mondiales…
Le but allait donc être de faire quelque chose d’effrayant pour rester dans le thème d’Halloween, en se servant de vieilles robes noires qu’elle ne mettait jamais pour éviter de taper dans les rideaux de la chambre…
CHALLENGE ACCEPTED !
… Mais Jade n’était pas là et pourtant, question vêtements sombres, s’était elle qui en connaissait un rayon… Oh et puis zut à la fin ! Elle n’avait qu’à pas partir pour chercher des réponses ou des questions ou peu importe, en plus elle avait raté les muffins… Fichue Souricette… Au moins elle ne râlerait pas en entendant le tactactactactactactactac frénétique du moteur de la machine à n’importe quelle heure du jour ou de la nuit…
Après une semaine de travail acharné qui aurait nécessité une ou deux Pupuce supplémentaires à jeter par la fenêtre… Ninon put enfin se parer de ses « habits de lumières » . Elle jeta un dernier regard dans le grand miroir à l’intérieur de l’armoire en déglutissant avant de sortir de la chambre pour rejoindre le lieu de la fête.
Elle avait opté pour un costume de sorcière… ou de folle, au choix, de toute façon c’était du pareil au même, surtout depuis que la moitié de l’institut la prenait pour une tarée… Tarée quand ça les arrangeait parce qu’ils ne disaient pas non à ses muffins… BANDE DE SALES INGRATS ! De toute façon, au train où allaient les choses, la vengeance divine ne se ferait pas attendre longtemps, parce qu’à force de manger ses pâtisseries, ils finiraient tous plus gras qu’ingrats…  
Breeeef, on divaguait, on divaguait mais à force de divaguer on dérivait vite !  Les pieds nus elle entrait maintenant timidement dans le gymnase en restant un instant plantée à côté de la porte d’entrée, comme si elle hésitait à repartir… Participer à une fête avec des gens était peut-être discutable maintenant qu’elle y était. Surtout lorsqu’elle vit les costumes des autres participants… Pourquoi la moitié des garçon avaient opté pour des styles de vampires badboys et pourquoi les ¾ des nanas avaient confondu costume d’Halloween avec costume de "princesse"/catwoman/soubrette/whatever... ? … Personne ne lui avait dit qu’il fallait venir avec le moins de vêtements possibles…
Nope, Ninon avait un vrai costume d’Halloween, noir et qui était censé faire peur ! … Même si faire peur avec une tête de hamster et de grands yeux bleus se révélait tout de suite problématique… Elle avait à la place détaché ses longs cheveux qui cascadaient maintenant le long de ses épaules et de son dos sous formes de boucles et de vaguelettes, jusqu’au creux de ses reins. Les mèches qui entouraient son visage avaient été réunies en deux tresses attachées à l’arrière de son crane. S’en suivant ensuite sa robe, complètement noire. Autour de son cou venait s’enrouler une sorte de col fait de plumes noires enchevêtrées dont les pointes s’échappaient parfois pour venir sur ses joues. Le buste était un dos nu ample en mousseline noire dont le style légèrement translucide et sans sous-vêtements était directement inspiré de celui d’Aislinn. Mais à la différence de la rousse, sa poitrine était assez petite pour se tenir et ne pas « sauter aux yeux ». Sa taille, quant à elle, était prise dans une ceinture faite de la même façon que son col et à partir de cette dernière descendaient plusieurs épaisseurs de mousselines sombres et translucides qui tombaient jusqu’à ses pieds nus. Elles étaient assez nombreuses et froncées pour cacher ses jambes, mais assez amples et légères pour voler et onduler autour d’elles à chacun de ses pas, dans le froufrou caractéristique des volants qui glissaient les uns contre les autres.
Ninon se ratatina légèrement en voyant la quantité de costumes multicolores, moulants et courts qui peuplaient la salle avant de se mouvoir, aussi discrètement que le lui permettaient les différents volants de sa robes. Elle rasa les murs pour arriver devant le saladier de punch, très certainement safe parce qu’après tout, qui viendrait mettre de l’alcool dans une boisson pour une soirée étudiante ? …
Non, l’alcool n’était pas important… Ce qui était important était de trouver le génie qui avait mis des fraises dans le punch, celui-là aurait mérité un baiser ! Des fraises ! Après des mois de recherches, elle les avait trouvé, mais pas dans une tarte… Non, à la place, elle étaient en train de barboter dans du jus d’orange entre des quartiers de pomme et des cerises confites… Ninon remplit son verre de fraises avant d’en manger une avec délice. Jésus Marie Joseph, le bonheur était pourtant si simple ! …
Par contre, le jus d’orange plutôt corsé lui fit froncer le nez et plisser les yeux…

Costume ♥:
 
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Kaede Kobayashi
Élève à l'Institut Gamma
avatar

Messages : 288
Date d'inscription : 04/03/2013
Age : 27

MessageSujet: Re: Halloween Night {Libre}   Mar 30 Déc - 1:10

Il y a des moments où l'on se sent fort, et d'autres où l'on se sent TERRIBLEMENT faible. A la vue de ce costume louable de ninja girl, je me suis vraiment sentie faible car , impossible de résister à le louer pour la fête d'Halloween. Surtout que c'était Rachel qui organisait et que je voulais ABSOLUMENT participer à la préparation avec elle. C'était important et ça me changerait les idées. En faites, cette préparation à changé les idées de tous le monde. Evidemment, silence absolue, j'avais réussi à ne le répéter à personne.

J'ai donc fait partie des petites mains qui avait fabriqué cette superbe soirée. Et je savais maintenant le travail assez titanesque qu'il fallait donner pour l'organisation et la préparation. Bon pour l'organisation, je ne m'étais pas encore trop investie. J'étais restée spectatrice et j'avais écouté, observé et appris comment on s'organise de la sorte. En revanche, pour la préparation, je m'étais découvert un petit coté perfectionniste pas désagréable mais tout de même bien casse-couille. Les tables ne sont pas symétriques ! Ce ballon n'est pas assez gonflé ! Ce ruban est trop bas.... Trop Haut... Trop à gauche ! Cette citrouille doit être ici ! Y a une tâche la ! etc etc...

Bref, cette fête Halloween, devait être parfaite. J'avais même fait mes petits rapports pour Rachel afin de lui indiquer l'avancée des travaux qui m'ont été confié pour toujours avoir quelque chose à faire. Je faisais preuve d'une grande motivation et ce mal-grès la soudaine pénurie de cookie et l'apparition de muffin pour les remplacer. Cet événement étrange ne m'avait pas trop marqué, mais juste assez pour rester dans un coin de ma mémoire pour essayer d’enquêter dessus, car je n'avais encore jamais trouvé l'origine de ces délicieux petit biscuit croquant au chocolat.

Je trouverais bien. En attendant,  je me retrouvais la, devant l'oeuvre de Rachel au quelle j'étais fière d'avoir participé ! En faites, il y avait un peu de moi dans cette soirée. Cependant j'avais tout de même un peu de surprise car je n'avais pas vu le résultat final, ordre de la grande rousse en personne pour nous laisser aussi le temps de préparer nos costumes et avoir un peu de surprise aussi lorsque nous retrouverions le gymnase

En effet, cette fois-ci je devrais me débrouiller par moi même. J'avais deux choix pour mon costume. Le faire moi même, ou l'Acheter/Louer. N'ayant aucune connaissance en couture le choix fut assez vite fait. En quoi je me costumerais ? Un rapide coup d’œil sur les boutiques en ligne de farce et attrape sur internet, m'avais offert la vision de ma faiblesse vestimentaire.

Bien que je ne pouvais pas aller en ville, où en tout cas que c'était encore très déconseillé, surtout pour moi, après les récents événements tragiques du moi dernier, j'avais pus le faire louer pour cette soirée par un intermédiaire, à savoir Laura Evans ! J'avais d'ailleurs hâte de voir en quoi elle viendrait !

Bref, j'avais craqué sur un costume de Ninja girl auquel j'avais rajouté quelques accessoires dans les cheveux.

Celui-ci était composé d'un tabi rouge bordé de blanc, fermée par une grande ceinture noire. Un boxxer noire m'enveloppait les hanches, fait de la même matière que la ceinture. Plus bas, de faux protège tibia dorée ornait mes jambes des genoux jusqu'au cheville et je portais au pied des talons noire assez haut. Les talons c'est pas ce qu'il y avait de plus facile mais en faites ça va ! C'etait comme marcher sur la pointe des pieds. Au pire je les enlèverais dans la soirée si j'ai trop mal. Le haut estétait quand à lui composé de faux cuir. Cela me prenait tous le cou et descendait juste au-dessus de ma poitrine. C'est sur cela que s'attachait deux épaulières ornées de motifs papillons asiatiques et de deux pointes. Mon visage &tait est caché à moitié du cou jusqu'au nez, cachant ma bouche et mes joues. J'ai rabattue mes cheveux en une longue queues de cheval, attachée par un grand ruban rouge et noire, lui aussi en forme de papillon. Je me suis aussi fait deux petites couettes qui descendent le long de mes pommettes. Enfin pour agrémenter le tout, j'avais des mitaines et protèges bras noire et un faux katana en plastique. Tout cela, pour la soirée, à 40$ ! J'étais pas mécontente, c'était beau et j'avais mon costume pour la soirée. Par contre, j'allais devoir y faire attention.

Kaede ninja !:
 

Rien qu'en pensant à l'an dernier, j'étais sur-excitée de celle qui venait. Quelles nouvelles boissons allais-je découvrir ? De nouvelles rencontrent ? Je voulais faire un carton et faire de cette soirée un moment inoubliable comme l'année dernière !

Lorsque je suis arrivée, maquillée et "arme" en main, il y avait déjà pas mal de monde et la fête battait son plein. Je redécouvrais alors ce à quoi j'avais participé, avec cette fois beaucoup plus de monde. Le résultat était géniale ! C'était halloweenesque !

Cependant,quelque chose me dérangeait un peu dans le fait que beaucoup de costume se ressemblais. Je trouvais cela un peu dommage. Les vampires étaient clairement à l'honneur, en tout cas, du coté homme. Chez ces mesdames, c'était déjà un peu plus fantaisiste. Sorcière, princesse, chat, tigresse et autres. Je faisait partit des autres. Bien qu'il n'y est pas eu d'autre ninja. En tout cas pas à première vu. Du coup, je me sentais un peu hors contexte. Aurais-je mal choisit ? Bah on s'en fout !

Je partit directement voir Rachel pour lui montrer mon beau costume. J'adorais le sien ! Cela me faisait penser à cet empereur français la... Bonatruc. Bon, je me suis plantée en beauté. Ce n'était ABSOLUMENT pas ça. Je suis nul en histoire que voulez-vous. Résultat, je me suis retrouvé devant Rachel a m'excuser de tout cœur de m'être trompé comme une quiche, lui faisant peut être croire que son costume n'était pas réussi alors qu'il était magnifique. Quoiqu'il en soit, je laissais ensuite Rachel à ces occupations en lui précisant que si elle avait besoin de moi, je restais dans les parages. On sait jamais, du ravitaillement d'urgence à faire ou autre.

Hormis ce petit incident, la fête continuait, et je décidait alors de quelques pas de dance sur la piste avant de retourner voir Rachel. D'abord timides, je commençais à prendre le rythme. Quelques garçons me reluquait et je n'avais pas vraiment l'habitude de ces regards, vu que ceux-ci me regardait plutôt comme étant l'une des cinglées de l'institut. La, le visage couvert, personne ou presque me reconnaissait dans la lumière colorée. Je baissais la tête, et visiblement, le costume avait tendance à s'ouvrir au fur et à mesure que je dansais créant un décolletée parfois trop insistant. J'ai donc passer touuuuuuuute la soirée à surveiller ce dysfonctionnement technique et le régler dès que ça s'ouvrait un peu trop. Oui, cela pouvait pas être parfait, malheureusement.

Je cherchais en même temps des personnes qui semblait familière. Je veut dire des personnes que je côtoie régulièrement car actuellement, toutes les personnes présentes ici sont des personnes que j'ai déjà vu ou croisée dans un couloir de l'institut. Et pour le moment je ne voyais que peu de vrais connaissances et amis. Ils arriveraient un peu plus tard, j'en étais certaine. Mon œil fut cependant attiré vers une élève toute en noir et en légèreté au niveau du punch. Son costume, vu de derrière se différenciait clairement des autres et il était vraiment jolie, en plus je commençais à avoir soif. Je me dirigea donc vers la boisson pour me servir cependant, la personne qui se servait déjà était comme extasié par par le contenu du punch et notamment par la présence de fraise. Du coup, elle avait encore la petite louche pour se servir dans les mains.

- Hmm... Excuse moi, mais je peut avoir la louche ? lui dit je avec mon plus beau sourire totalement indiscernable sous mon masque, petit détail que j'avais complément zappé.

_________________
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Echo
X-Men Oméga
avatar

Messages : 1011
Date d'inscription : 10/05/2012
Age : 23

MessageSujet: Re: Halloween Night {Libre}   Mar 30 Déc - 16:36

La grande majorité de ses proches étaient loin, Jade était retournée auprès de Kyle Kenneth en Arizona tandis que le reste des Elioth de Lauro faisait la veillée traditionnelle en Irlande, Sanzo était reparti à Miami avec ses potes et son père, bref l’Institution c’était vidée comme à chaque vacances. La population avait eue beau bien baisser, il n’en restait pas moins des personnes pour y être encore, par choix ou à défaut d’avoir autre part où aller. C’était un peu son cas, c’était entièrement celui de certaines de ses connaissances. Kaede, oui, qui avait tâché d’aider en bonne ouvrière-décoratrice et était revenue presque méconnaissable, si on exceptait ses petites cornes, ses gros seins et ses yeux rouges. Une ninja, est ben dites-donc ! Le rouge lui allait et se combinait assez bien avec le noir, mais voir cela arrivé à talon et avec la moitié du visage de caché était assez amusant ; ah, les premières fois avec les talons ! D’autant qu’ils étaient sacrément plus hauts que ceux de l’année dernière et du costume de Phénix qu’elle avait porté, et il ne manquait plus qu’elle marche sur la ceinture tombante et elle en ferait autant. Après les fringues avait été faites seules, ou tout du moins achetées seules comme le suggérait l’étiquette. Une bonne chose que Kaede commence à s’intéresser au monde extérieur, ce qui était sans doute en parti du fait de Laura Evans qui avait du tenir compte de l’avertissement. Le Phénix ne plaisantait pas au sujet de ses protégées, même celles qui s’étaient émancipées. Ce fut d’ailleurs à son approche et en clin d’œil qu’elle demanda à ce qu’on passe à une autre musique de la playlist qu’elle avait faite pour cette soirée. Après les français, il était temps de passer quelques minutes au son nippon ; et non, son costume n’était pas inspiré d’un français ! Qu’est-ce elle pouvait bien en savoir de la France, elle n’y avait jamais foutu les pieds et n’avait déjà que les bases de l’histoire de son propre pays alors aller chez les autres… pff. En plus vu le niveau scolaire de Kaede elle aurait du le voir récemment ! Mais nan, ce n’était pas grave, c’était le tricorne qui posait problème, même si Napoléon avait un bicorne. Ouais, la Cornue restait dans les parages, aucun problème ; l’Echo n’avait pas l’intention de rester sur son perchoir toute la soirée de toute façon, elle attendant des gens et mettait les choses au point. Des choses que Kaede avait intérêt à suivre !

Fashion Monster (Extended Mix) by Kyary Pamyu Pamyu on Grooveshark


Après la Cornue n’était pas la seule à capter son intérêt et il n’était nullement une surprise que de la voir ici après ce qui c’était passé l’année précédente, chez Nobody. Neassa Boadicée Dorian, une autre proche à être venue et à avoir participé en tant qu’organisatrice ; elle tenait à faire des fêtes avec elles, cela faisait trois ans maintenant depuis la soirée avec Caitlyn et Jubilee bourrées, et n’ayant pu accomplir celle à sa villa de Rochester du fait du climat tendu au-dehors elle c’était investie dans celle-ci. L’éternelle jeune femme avait été touchée par le contrecoup de Bleecker Street comme un certain nombre d’autres mais l’Empathie avait commencé à faire du dégât au point qu’elle se sépare de son hôte malgré les années depuis lequel elle l’habitait. Elle avait encaissés les ressentis de bien des catastrophes mais considérant le nombre d’élèves à s’être traumatisés de Bleecker elle n’avait pu tenir. Néanmoins sa prévoyance lui avait assurée une liste de « donneuses » qui lui valait donc une présence physique certes nouvelle mais pas désagréable. Un peu plus petite que Rachel malgré qu’elle était elle aussi rehaussée par des bottes à talons compensés noires lui remontant jusqu’en haut des cuisses, Neassa maniait également le noir et le rouge puisque sa culotte était de la première couleur également et apposée sur les collants d’un juste-au-corps rouge sombre à l’instar de la cape qui lui enserrait la gorge et tombait jusqu’à ses pieds. Comme le reste, son bustier avait été fabriqué artisanalement et voyait diverses plaques rouges accrochées à une base de fausse-mailles, tandis que son casque reprenait la forme de la figure philosophico-politique en laquelle elle c’était déguisé. Les cheveux blonds juraient pas mal avec le reste, pour l’Echo, même si elle c’était facilement faite à cette nouvelle apparence plus remarquable que les précédentes, les sens psychiques et la perception de l’esprit de Boadicée aidant.

L’autre télépathe tenait par la main un garçonnet qu’en revanche, il était surprenant de voir ici. Du bruit, des gens, des couleurs dans tous les sens, voici qui n’était pas la tasse de thé de John Mackoley même si c’était positif de le voir ici. Bleecker Street ne l’avait pas atteint lui mais il était toujours traumatisé de l’apparition de sa mutation et très isolé, tant part son âge vu qu’il n’avait pas la dizaine que par sa mutation, la peur qu’il en avait et qui l’avait pratiquement rendu muet ainsi que celles qu’il pouvait inspirer aux autres. Pas méchant pour un sous mais mal adapté, Rachel avait suivi son parcourt depuis que l’équipe de récupération l’avait ramené et le Triskelion autorisée sa tutelle. Si l’on pouvait considérer l’existence de ce que les Cuckoos avaient en leur temps nommé « Club des Télépathes », le petit John en était sans doute le protéger et qu’il se soit décidé à venir ne pouvait être que positif, tant que l’on évitait le bordel déclenché par la moindre utilisation de ses capacités mutantes. Bon, il n’était pas déguisé mais il était là au moins, ce qui était une progression certaine dont sa marraine ne devait pas être étrangère.

*Chacun son type de leader,* plaisanta Nobody en guise de salutation, faisant sourire Rachel qui acquiesça de la tête, avant que leurs deux regards ne se tournent vers l’enfant. *T’as vu, il a mit un costume. Pas un déguisement mais si on lui demande on dira que c’est un mafieux.*

Posant un genou à terre, l’Echo sourit à l’enfant et commença à agiter ses doigts, ce dernier lui répondant par le même langage. Il était plus impressionné qu’autre chose et trouvait qu’il y avait trop de monde mais il était content d’être venu. Elle aussi et s’il avait besoin d’une traductrice lorsque Neassa serait à quatre pates sur le sol, qu’il n’hésite pas à venir la voir.

*Saleté ! Je suis plus Empathe, pas question de finir ivre surtout quant je chaperonne John.*

*Ouef mais comme c’est toi qui gère officieusement l’alcool, je suis presque sure que t’y touchera un peu. Tu disais pas que tu avais une réputation à tenir ?*

D’ailleurs en parlant d’alcool… laisser les élèves libres d’amener leur consommation personnelle en menaçant de punition ceux qui faisaient des conneries avec c’était son idée et passablement son rôle, Neassa préférait proposer sur son apport personnel afin de juguler, mais il y en avait d’autres qui n’avaient pas tant de jugeote dans les deux cas. Et l’attention de Rachel c’était faite bernée, ce qu’un simple suivit d’une Kaede au costume peu coopératif vers les boissons lui fit se rendre compte. Le visage de l’Echo se durcit un instant alors qu’elle entreprenait de revenir sur ses jambes, un exercice plus compliqué qu’il n’y paraissait avec de tels talons.

Entreprenant de marcher alors que Neassa avait réagit à similaire vitesse pour l’accompagner, entrainant le troisième à la suite, Rachel s’en alla accomplir son devoir même si elle fut ralentie par la nécessité de contourner la piste de danse formée au milieu du gymnase. Basiquement, un ponch était une boisson non alcoolisée préparée avec cinq fruits, là celui-là il c’était vu transformer en ti-ponch ! Qui était une question qui viendrait plus tard, même si elle avait déjà des soupçons concernant qui était autour.

- J’espère qu’on vous a mit au courant qu’il était alcoolisé, déclara-t-elle simplement lorsqu’elle arriva au niveau des deux autres jeunes femmes, accordant un regard à Ninon dont la robe allait en continuation de sa chevelure détachée qui ne lui allait pas mal du tout. Kaede, si tu prévois de te cuiter, tu mets les inhibiteurs, ok ? Nini… le dos-nu te va bien.

- Salut Kaede, comment ça va depuis le temps ? Toujours à goûter à tout, reprit Nobody, avec un sourire contrastant avec la déception de sa comparse. Cherche pas, tu me reconnaitras pas ; j’ai, disons, changée d’apparence depuis la dernière fois. C’est Neassa, Nobody. Je te présente John, et vous vous êtes…

S’étant tournée vers les concernés alors même qu’elle parlait, toujours le casque sous le bras, elle fixa Ninon en attendant une réponse alors même que le garçonnet saluait doucement de la tête sans quitter les deux autres des yeux, bien plus craintif envers la nippone du fait de sa réputation.
PNJ:
 

_________________
Phénix

"Des monstres ont fait de moi un monstre,
Des divinités ont fait de moi une divinité,
Seuls les humains peuvent faire de moi une humaine."






731 Posts Rp
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Ninon Lenoir
Élève à l'Institut Beta
avatar

Messages : 243
Date d'inscription : 09/07/2014
Age : 24

MessageSujet: Re: Halloween Night {Libre}   Mer 31 Déc - 13:17

Ninon s’affairait avec concentration à remplir à nouveau son verre avec les fraises du punch après avoir vidé le premier. Consciencieusement, elle partait donc à la pêche à la fraise, armée de sa louchette pour aller les cueillir une à une, et ainsi les sauver de la noyade. Quand la louchette était pleine, elle les faisait ensuite tomber avec soin, et en les comptant, dans son gobelet en plastique (ah, les fameux gobelets rouges … COMME LES FRAISES !), ou elles venaient s’entasser, toujours plus hautes et proches du bord du récipient.
Alors qu’elle effectuait son geste avec toute l’exactitude que le premier service de fraises lui permettait, elle se murmurait pour elle-même en français.

_  Et une fraise pour Ninon… Deux fraises pour Ninon… Trois fraises pour Ninon… Tr… De…
Rho zut, j’perdu l’fil … hannn… Bon, concentration Nini, concentration.
Une fraise pour Nini, deux fraises pour Nini, trois fraises pour Nin…
*


_ Hmm... Excuse moi, mais je peut avoir la louche ?

_ Han ! La qu…

Alors que Ninon était surprise dans ses comptes, elle laissa tomber toutes les fraises de la louches et ses dernières dégringolèrent d’un seul coup directement dans son verre dans un petit bruit de chute et d’empilement. Elle regarda donc les fruit avec un air profondément triste et déçu, et soupira. Au moins le sort avait décidé de toutes les faire arriver dans son verre sans en reverser aucune à côté!
ET BIM ! Prends ça dans ta face la fatalité, la Nini était plus maline qu’elle n’y paraissait, car aujourd’hui, tu n’avais point pris de vie !
Finalement, elle haussa simplement les épaules en soupirant de résignation.

_ …Tompis… *

Elle releva doucement la tête des fruits pour voir qui lui faisait face, et surtout comprendre ce qu’on lui voulait… Elle n’avait pourtant rien demandé à personne puisqu’elle avait simplement rasé les murs puis compté les fraises du punch, avant de les savourer l’une après l’autre en fermant les yeux de délice. Chacun des fruits faisait un peu plus rosir ses joues, son plaisir augmentant à peu près au même rythme que son alcoolémie.
Dooooonc, une fois un sourire aimable, mais tout de même un tantinet niais, en place sur ses lèvres de la même couleur que ses joues et que des fraises qu’elle avait mangé! Elle put commencer à appréhender ce qui ce trouvaient en face d’elle. A savoir, un individu de sexe indubitablement féminin à en juger par ses appendices mammaires surdéveloppés, peu vêtu et aux cheveux rouges.
Elle semblait en plus la regarder avec une certaine insistance ! Les joues de Ninon s’empourprèrent un peu plus, c’était flatteur après tout, et elle lui répondit donc tout naturellement en ajoutant un soupçon de niaiserie supplémentaire dans son sourire. Malheureusement, après un sursaut de présence d’esprit, elle eut l’idée de suivre son regard et donc de découvrir que l’inconnue cherchait plus à séduire la louche, qu’elle-même.
O, quel tragique râteau alors même qu’aucun mot n’avait encore été prononcé ! Une histoire d’amour tuée dans l’œuf.
O, quel désespoir que de s’être faite doublée par un ustensile en inox !
C’te hontasse d’être moins attirante qu’une vulgaire louchette ! Et ce n’était pourtant pas faute d’y avoir mis les formes. Petites formes, certes, mais tragiquement, il fallait faire avec les moyens du bord lorsque l’on était pas pourvu de l’importante paire de formes de la vis-à-vis louchophile !
Ninon passa son regard de la dite vis à vis à la louche, et inversement. Elle soupira, presque honteuse, mais qui était-elle donc pour empêcher une si belle histoire de s’écrire ? QUI ? Elle se résigna donc et finit par lui tendre l’ustensile, alors qu’une nouvelle voix se faisait entendre, et pas n’importe quelle voix, LA voix.

_ J’espère qu’on vous a mis au courant qu’il était alcoolisé.

Alcooliquoi ? … Nopidy nope! Personne ne n’avait mentionné que les fraises étaient aussi traîtresses que des pommes empoisonnées ! Sans compter qu’alcooliser les fraises de Ninon était aussi vil que si on lui avait offert du chocolat truffé de LSD.

Cette dernière écarquilla les yeux dans le vague alors que la louche lui échappait des doigts. Cette dernière retomba donc dans le saladier de punch et la française tourna son regard émerveillé vers la provenance du son qu’elle aimait tant.  La sienne était niaise à souhait, à l’instar des petites étoiles qui naissaient dans ses yeux enchantés quand elle contempla Rachel de bas en haut.

_ Ooooh, Rachel !
Jésus Marie Joseph, ce que tu es joliiiie …. T’as grandi dis donc.


Grandi était un euphémisme puisque la rousse n’était déjà pas naturellement petite, mais là, le fait qu’elle fut perchée sur des talons et qu’un immense chapeau fut lui-même perché sur le haut de sa tête lui ajoutaient très certainement assez de centimètres pour lui faire attendre aisément les deux mètres de hauteur. Pieds nus, Ninon ne pouvait l’observer que tu haut de ses presque 1m60, plus de 40 centimètres en contrebas.

_ Kaede, si tu prévois de te cuiter, tu mets les inhibiteurs, ok ? Nini… le dos-nu te va bien.

En entendant son surnom et le compliment que sa muse rousse venait de lui offrir, Ninon gloussa légèrement en rosissant d’avantage et plongea son regard dans son gobelet rempli de fraises.

_ Salut Kaede, comment ça va depuis le temps ? Toujours à goûter à tout. Cherche pas, tu me reconnaitras pas ; j’ai, disons, changée d’apparence depuis la dernière fois. C’est Neassa, Nobody. Je te présente John, et vous vous êtes…

Ninon releva la tête, son sourire amoureux flottant toujours sur ses lèvres. La blonde la regardait avec insistance et elle rougit encore, décidément que de succès ce soir, elle devrait mettre de la mousseline plus souvent… Mais au bout de quelques secondes à se regarder dans le blanc de l’œil, l’une rougissante et l’autre déjà moins, Ninon se rendit compte qu’elle attendait peut-être quelque chose. Se rappeler des conventions, se rappeler des conventions… Oh ! Se présenter !

_ Mmh ? Ah, Ninon, c’est mon p’tit nom ! Baissant les yeux, elle aperçut le jeune garçon et lui sourit gentiment avant de fléchir les genoux jusqu'à arriver à la même taille que lui, et toi alors, c’est quoi ton p’tit nom mon lapin?


Dernière édition par Ninon Lenoir le Dim 4 Jan - 13:25, édité 2 fois
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Kaede Kobayashi
Élève à l'Institut Gamma
avatar

Messages : 288
Date d'inscription : 04/03/2013
Age : 27

MessageSujet: Re: Halloween Night {Libre}   Sam 3 Jan - 17:23

Je fut des plus surprise de voir que que la jeune fille devant moi était dans un état assez étrange. Était-ce normal ou alors peut être qu'elle en avait déjà pris un peu trop ?  J'en avais alors directement déduis que le jus contenant ces délicieuses petites fraises était probablement agrémentée d'un petit ajout du fameux liquide que j'ai goutté il y a un an jour pour jour et qui m'a valu un pourlèchage de bouche en bonne et due forme avec pour conséquence la perte d'une grande partie de mon innocence.

Bref, ce breuvage, que je voulais boire il y a de cela quelques secondes m'attirait tout de suite un peu moins. En effet, je m'attendais à un mix de jus de fruit, un coktail sans alcool, bien sucré et que l'on pouvait boire à foison en ne risquant que des aller-retours intempestifs au toilette pendant la nuit pour soulager une vessie trop pleine. La, je risquais un un bon retour vers le fu...passé.

Ainsi, la jolie blonde relâcha la louchette, toute déçue de devoir stopper la sa chasse à la fraise. Elle avait l'air bien moins fraîche que ce que je le pensais et me regardait maintenant avec un grand sourire. J'en profitait du coup, maintenant qu'elle me faisait face pour regarder, autant qu'elle le faisait, son costume. Il était tout de mousseline noire, léger et me rappelait un peu le style gothique de Jade, en plus fin . Cependant, il me fallut un second passage pour me rendre compte que la mousseline était transparente. Et que l'on pouvait deviner une poitrine en dessous par transparence. C'était tellement léger qu'il fallait vraiment forcé pour le remarquer. Je reportais alors plutôt mon attention sur la la louche pour ne pas éveiller quelques pulsions. Je redoutais qu'elle vienne elle aussi venir m'embrasser comme Rachel.

Coïncidence ou non, ce fut quand je me rappela se souvenir langoureux que la voix de la personne en question se fit entendre derrière moi alors que je réceptionnais la petite louche.

- J’espère qu’on vous a mit au courant qu’il était alcoolisé.

- Ooooh, Rachel !
Jésus Marie Joseph, ce que tu es joliiiie …. T’as grandi dis donc.


Et bien voila, soupçon confirmé ! La jolie blonde en face de moi était bien un peu imbibée a cause du liquide que j'allais boire dans quelques secondes. Je répondis alors exactement comme ma voisine, quasiment synchro.

-Kaede, si tu prévois de te cuiter, tu mets les inhibiteurs, ok ? Nini… le dos-nu te va bien.

-Aï ! De toute manière j'avais pas prévue de le faire. Je goutterais un peu mais je referais pas la même erreur que l'an dernier. Enfin, erreur... C'était pas non plus désagréable. Mais je ferais attention. Enfin tu m'as comprise !

Rachel n'était pas venue seule. Mon regard se posa sur une fille totalement inconnue au bataillon à mes yeux et un petit garçon qui me semblait bien jeune pour être ici. L'inconnue vint alors m'aborder comme si l'on se connaissait déjà. Oula !

- Salut Kaede.

Ah, elle connait mon prénom !

-Comment ça va depuis le temps ? Toujours à goûter à tout.

Euh, si je savais qui tu es je pourrais te le dire. Je cherchais dans ma tête ou j'avais bien pus voir cette personne. Visiblement, elle me connaissait, c'était certain. Mais je ne voyais absolument pas qui cela pouvait être.

- Cherche pas, tu me reconnaîtras pas ; j’ai, disons, changée d’apparence depuis la dernière fois. C’est Neassa, Nobody. Je te présente John, et vous vous êtes…

Ah, ça je connais ! On oublie assez vite qu'ici les apparence sont très trompeuses. C'était donc l'hôte de la fête de l'année dernière. Une personne à qui l'on peut rien cacher ! J'étais contente de la reconnaître et de la revoir. Et le petit bonhomme s'appelait John donc.

- Mmh ? Ah, Ninon, c’est mon p’tit nom ! Et toi alors, c’est quoi ton p’tit nom mon lapin?

Et elle c'était Ninon! Wouhou victoire ! ça y est je savais qui était qui maintenant. En revanche, elle ne semblait pas avoir entendu le nom que Nobody avait donné pour John, et celui-ci semblait plutôt timide. Mais cela ne serait pas un mal s'il se présentait lui même. Du coup, il me fallait aussi me présenter, pour John et Ninon en tout cas.

- Il s'appelle John. Moi je suis Kaede Kobayashi. Je suis d'origine japonaise, comme vous pouvez l'entendre. Je suis en 2ème année de réinsertion et j'espère pouvoir entrer dans des classes plus poussés l'année prochaine. Mais il faut d'abord que je m'améliore encore bien que je soit sur la bonne voie.

Je voulais pas passer plus pour une folle que ma réputation n'en disait sur moi. Alors, je préférait simplement indiquer mon parcours scolaire. Actuellement, en plus de couvrir la plupart de mes lacunes j'apprenais toujours et encore comment se comporter. J'étais pas vraiment encore apte à survivre en ville seule. Mais au sein de l'institut, ma sociabilité augmentait.

Je lançait un grand sourire "masquée" à Nobody, John et Rachel et comme j'avais la louche pourquoi ne pas en profiter pour servir tout le monde !

-Je vous sert quelques chose ? Il y a ...

Je regardais vite fait les boissons disponible.

-Jus d'orange, de Cranberries, de Cassis, de raisin, punch... pas pour John du coup, Coca, "Redboule" ?

Ne connaissant pas la fameuse boisson énergétique, je ne savais trop comment la prononcer. C'était donc sortit en phonétique de base.

Je me servais alors en jus de raisin bien sucrée en attendant la réponse des autres.

_________________
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Echo
X-Men Oméga
avatar

Messages : 1011
Date d'inscription : 10/05/2012
Age : 23

MessageSujet: Re: Halloween Night {Libre}   Dim 4 Jan - 14:48

- Ooooh, Rachel, commença Ninon avec une voix d’un bonheur particulier alors même qu’elle laissait tomber la louche et détaillait celle à qui elle s’adressait. Jésus Marie Joseph, ce que tu es joliiiie… T’as grandi dis donc.

Bon… la française avait l’air d’être déjà très voir trop bien partie et risquait fort de ne pas finir la soirée, le tout à cause d’un alcool en libre service alors même que c’était là quelque chose d’interdit ; et pire que tout elle n’avait pas été prévenue de ce qu’elle sifflait… la soirée commençait bien… En tout cas le compliment lui fit plaisir, l’Echo complexait toujours sur son physique malgré le travail de monstration et d’acceptation de ses cicatrices dont les seules visibles en cette soirées étaient celles sur ses bras et ses épaules, soit le trio de lacération sur son côté gauche, la première partant de l’arrière de l’épaule pour disparaitre entre l’épaulière et la queue de pie, la seconde descendant de similaire point jusqu’à l’aisselle et la troisième marquant le bras de façon presque horizontale ; enfin, moyennant que la malchance et les aléas de ses mouvements ne dévoilent pas quelques autres comme celle verticale sur l’arrière de la cuisse de ce même côté ou encore l’impact de balle sur l’autre cuisse. Dans tous les cas, cela resterait moins pire que la Marque du Phalkon ou les Marques d’Assermentation des Limiers, toutes deux parfaitement cachées. Mais elle ne devait pas faire de hors sujet, elle était là pour une chose précise et ce n’était pas tellement faire rougir et glousser Ninon.

-Aï ! De toute manière j'avais pas prévue de le faire. Je goutterais un peu mais je referais pas la même erreur que l'an dernier. Enfin, erreur… C'était pas non plus désagréable. Mais je ferais attention. Enfin tu m'as comprise !

Il y avait beaucoup de choses à comprendre avec cette déclaration mais Kaede était grande, elle faisait bien ce qu’elle voulait tant que ça n’avait pas de conséquences graves ni n’était interdit au préalable. L’Echo lui faisait confiance et entreprit de se détourner alors que Neassa faisait la conversation, laissant la Cornue perplexe jusqu’aux énoncés de noms et la Bourrée rougir après ces dernières, observant tant du regard que de l’esprit les environs en vérifiant non seulement que d’autres boissons n’aient pas été infectées ou désinfectées, selon le point de vue, tout autant que les suspects d’un tel acte ; heureusement qu’il y avait pas mal de récidivistes à l’Institut, ça limitait les recherches.

Son P’tit Nom c’est Ninon, c’était bien trouvé ; plus que le lapin en tout cas. Rachel ne connaissant que deux comparaisons avec le lapin, la première était gustative et la seconde décevante, mais c’était surtout le niveau de suivit de la française qui impressionnait. Kaede entreprit de rattraper la situation comme elle pouvait alors que John regardait l’ivre avec de grands yeux, se tournant d’abord vers Neassa pour la traduction puis vers celle qui venait à son secours, écoutant attentivement malgré la musique qui continuait d’être énergique.

Wanted Man by Rev Theory on Grooveshark

- Deuxième et dernière année de réinsertion, après tu seras en cursus normal, encouragea Nobody avec le sourire. Et toi Ninon, tu es en quoi ?

Si on lui demandait, Neassa répondrait bien volontiers qu’elle faisait sa première année de doctorat d’ingénierie, avec une thèse sur les énergies renouvelables, et sa seconde année de master de psychologique, néanmoins elle ne l’avancerait pas d’elle-même pour ne pas imposer sa science ; chose qu’elle ne ferait pas non-plus après à moins qu’on lui demande plus amples explications.

- Je vous sers quelques chose ? Il y a…

- Je reviens, déclara distraitement Rachel, partant avant même l’énoncée des boissons qu’elle connaissait déjà pour les percevoir plus que par souvenir de ce qu’ils avaient mit en libre-service.

- Redbull, c’est une boisson énergétique et un sponsor pour pas mal de trucs. Je prendrais un peu du ponch avant que Rachel foute la tête de celui qui l’a trafiqué dedans.

Le garçonnet regardait celle qui avait cité son nom, qu’il observait de toute façon plus que l’autre, puis pointa simplement du doigt le coca lorsque son tour vint, hochant la tête en conclusion.

- Si je puis me permettre, peut-être arrêter le ponch aussi pour toi Ninon, au moins le temps que ça redescende ?

Op, d’un second verre potentiel pour Neassa qui oubliait potentiellement qu’elle n’avait encore jamais fait de fête avec ce corps-là et donc qu’elle n’avait aucune idée de sa tolérance à l’alcool, mais de toute façon Rachel ne pouvait pas tout gérer et pour l’heure elle croisait les bras sur sa poitrine face à un élève dont elle estimait trop connaitre la tête par rapport au temps qu’ils avaient passés ensemble comme à sa connaissance de son caractère et de son passif.

- C’est quoi ton excuse cette fois, Tony ? Tu tâches de rendre quelques personnes plus coopératives pour poser pour tes nus ?

L’étudiant en art l’avait regardée venir, non sans une levée d’yeux au ciel et une réflexion à ses camarades, mais n’avait pas bougé ni n’était moins à son aise qu’à l’habitude. Il avait fait un certain nombre de conneries et récolté un certain nombre de punition tout en clamant encore plus qu’il était incompris ; le fait d’enfermée des filles dans leurs douches ou de les prendre en photo dans leurs bains en tenait du pur emmerdeur mais il fallait reconnaitre qu’il était doué et qu’il était plus impliqué que la moyenne dans la cohabitation pacifique, même s’il avait tendance à l’utiliser comme excuse pour ne pas se faire exploser. Il c’était assez calmé depuis qu’il avait fait le lien entre Rachel et le Phénix au-dessus de New York, de crainte de l’énerver sans doute, mais avait visiblement récidivé ce soir.

- Euh, non, pas vraiment, répondit-il « de toute bonne foi », comme toujours, les seules photos que je ferais ce soir c’est pour les costumes, puis franchement y’en a certain qui sont pas si loin des nus de toute façon.

- Si je cherche dans ta tête, je ne trouverai aucun lien entre toi et le ponch alcoolisé ?

- Alors ça… il y aura des liens à venir mais je n’ai pas encore bu, parole de scout.

- C’est pas toi qui l’a alcoolisé ?

- Tu as dit qu’on pouvait amener notre consommation, c’est la mienne. C’est même moi qui l’ait fait, tu remarqueras que les fruits qui sont dedans ont des complémentarités et des oppositions chromatiques et…

- Ta gueule, le coupa Rachel sans changer de position. Vous amenez votre alcool, ok, mais vous le laissez pas en libre service.

- Ah… Je vais le chercher et je laisse trainer à part, c’est ça ?

- Si tu surveilles qui en prend, oui. Faut juste éviter les incidents avec ça, y’a des mineurs.

- Et des alcoolos aussi. T’inquiètes pas, j’ai pigé. Tu peux dire à Nobody que je lui confie, c’est elle l’experte en alcool.

Experte en cuite plus qu’en alcool mais Rachel hocha la tête ; de toute façon, c’était l’idée de Neassa que de s’occuper d’un stand dans le genre. Du fait, elle s’en retourna faire passer le mot à la blonde casquée puisqu’elle avant besoin de ces deux mains libres, une pour le gobelet et l’autre pour John même si elle ne le tenait pas constamment.

- NBD, t’es la préposée aux alcools, déclara l’Echo en se réinsérant dans la conversation avec la finesse d’un trente-six tonnes, interrompant au passage ce qui pouvait bien se dire.

- Ça marche à deux conditions. Tu me libères une table pour entreposer le matos à l’écart et tu accordes une danse à Ninon. Elle en meurt d’envie.

Relevant les sourcils, Rachel regarda celle faisant la demande et celle en profitant, pour refaire le trajet inverse. Nobody semblait assez amusée par la situation et si la rousse ne parvenait pas à savoir comment elles en étaient arrivées là, elle interrogea la concernée du regard.

_________________
Phénix

"Des monstres ont fait de moi un monstre,
Des divinités ont fait de moi une divinité,
Seuls les humains peuvent faire de moi une humaine."






731 Posts Rp
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Ninon Lenoir
Élève à l'Institut Beta
avatar

Messages : 243
Date d'inscription : 09/07/2014
Age : 24

MessageSujet: Re: Halloween Night {Libre}   Mar 6 Jan - 23:02

_ John, mais bien sûr !

Ninon écarquilla ses yeux avec émerveillement, l’information ayant enfin trouvé le bon chemin pour arriver à destination au bout du deuxième essai. La première mention du nom du garçonnet avait dû se retrouver perdue à un croisement et ne manquerait pas de faire rougir de honte la française en survenant une fois qu’elle aurait décuvé pour de bon. En attendant ce douloureux moment, elle se redressa pour tenter de suivre la conversation et laisser Little John à son air contemplatif, non sans lui avoir offert un sourire rassurant avant pour palier à ses grands yeux intimidés.
Maintenant que la jeune fille aux cheveux rouges le précisait, le fait qu’elle fut japonaise donnait beaucoup plus de sens à son costume, peu couvrant mais néanmoins très seyant, de ninja. Sans compter ses yeux rouges en amande qui auraient d’autant plus dû mettre la puce à l’oreille de Ninon. Malheureusement, après un gobelet de fraises savamment arhumatisées, il fallait quelque chose de légèrement moins subtil qu’une puce pour lui faire remarquer ce qui sonnait comme une évidence.
Même s’il y avait des évidences qui ne trompaient jamais, sobre ou non. Comme la couleur des cheveux, par exemple.
Or, Kaede venait d’augmenter le club des roux de l’institut (même si techniquement ses cheveux étaient rouges, ils entraient quand même dans la catégorie « crinière de feu »), dont les membres se montraient chaque jour plus nombreux …. L’institut était d’ailleurs surement le seul endroit du monde où les rousses se présentaient comme les chocolats : toujours par deux.

_ Je suis en 2ème année de réinsertion et j'espère pouvoir entrer dans des classes plus poussées l'année prochaine. Mais il faut d'abord que je m'améliore encore bien que je sois sur la bonne voie.

_ Deuxième et dernière année de réinsertion, après tu seras en cursus normal.

Ninon mangea une énième fraise avant de regarder Kaede en penchant légèrement la tête sur le côté. Tout devait tomber sous le sens lorsqu’on la connaissait, mais hors contexte et avec un léger coup dans le nez, ses histoires de réinsertion, de classes plus poussées et d’amélioration étaient tout ce qu’il y avait de plus flou. Et puis cela ne disait pas ce qu’elle faisait.

_ Réinsertion ? Tu veux te réinsérer dans quoi ?

_ Et toi Ninon, tu es en quoi ?

_ Moi ? Elle tourna la tête vers Nobody avec un grand sourire après qu’une nouvelle fraise ait disparu du gobelet vers ses lèvres. Je fais de l’histoire de l’art et c’est chouette ! On apprend plein de choses et plus tard, j’aimerais bien les apprendre aux gens en devenant professeur ou guide dans un musée. Je pourrais avoir un petit parapluie rose que je lèverai dans les airs et toute une armée de japonais curieux qui me suivront en prenant des photos !

_Je vous sers quelque chose ? Il y a ...  

Alors que Kaede faisait la liste des boissons disponibles, Ninon regarda Rachel s’éclipser un peu plus loin en serrant son verre de fraises à deux mains contre sa poitrine. Elle soupira longuement, faisant s’abaisser doucement ses épaules alors que ses yeux remplis d’étoiles papillonnaient. Ah Rachel… Même en colère avec un chapeau ridicule elle était belle…  

_ Si je puis me permettre, peut-être arrêter le ponch aussi pour toi Ninon, au moins le temps que ça redescende ?

_ Oh ? L’intéressée retourna son attention sur la blonde qui semblait vouloir lui suggérer de troquer son trophée de pêche pour quelque chose de moins enivrant. Mais pourtant je n’en ai pas bu une goutte ! Ce qui n’était pas faux d’ailleurs puisqu’elle s’était contentée des fruits qui nageaient paisiblement en surface du saladier sans toucher à leur jus. Elle baissa alors le nez vers son verre et les fraises qui le remplissaient encore à moitié avant de relever la tête vers Nobody. Remarque, c’est vrai que les fraises ont l’air de rendre amoureuse ! Hihi !
Han mais oui !
Le sourire de Ninon s’agrandit alors qu’elle semblait avoir eu une révélation et elle se tourna vers l’asiatique, Une armée de japonais ! Kaede, tu vas souvent dans les musées dis ? Parce que tu pourrais être la première de mon armée, et comme tu es rousse, tu pourrais être Générale ! Alors, qu’est-ce que tu en dis ?
Mes soldats curieux et ébahis auront besoin d’un leader charismatique et ton air mystérieux derrière ton masque te désigne directement pour ce poste !
Uh ? Ah non Mlle Nobody, tu ne peux pas faire partie de mon armée ! Faut suivre, j’ai dit que c’était une armée de japonais, pas de blondes ! J’aurais l’air de quoi moi avec une armée de blondes ?Tout le monde pense déjà que je suis stupide et pourtant, je ne suis pas blonde ! Nope, je suis châtain claire.  
Enfin, ce que je veux dire, c’est que les cheveux ne sont pas un problème, c’est juste que Kaede est rousse et… et…. et… et… et… C’est juste une très jolie couleur. Enfin le blond aussi est une jolie couleur mais elle ne me fait pas saigner du nez !

Elle prit une fraise en soupirant.
Et flûte, j’avais dit que les fraise c’était fini… Bon, c’était la dernière… De toute façon, j’ai pas d’chance avec les rousses… ni avec les autres parce qu’il a suffi que je dise à une brune que je l’aimais pour qu’elle fuie à l’autre bout du pays… Alors que je l’aimais pas comme j’aime les rousses, Jade je l’aime comme ma moitié d’orange, c’est ma cachette secrète à bonheur !
Alors je ne peux définitivement pas dire aux rousses que je les aime, sinon elles changeraient certainement de pays… Voir pire encore !
… Pourquoi je parlais de rousse déjà ? … Ah oui, les fraises ! C’est bon quand même.
Et vous saviez que Rachel fait de la pâte d’amande délicieuse? Elle fait une sorte de prière avec les mains jointes et quand elle les rouvre, il y a de la pâte à l’intérieur.  Si si c’est vrai, même qu’elle m’en a donné.
Elle soupira. C’était parce que je pleurais… Mais les rousses me vont pleurer aussi.
Pourquoi j’aime pas les blon…


- NBD, t’es la préposée aux alcools.

_ Oooh, Rachel !

_ Ça marche à deux conditions. Tu me libères une table pour entreposer le matos à l’écart et tu accordes une danse à Ninon. Elle en meurt d’envie.

La française leva ses yeux ronds vers la blonde, une expression d’interrogation choquée plaquée au visage.

_ Plait-il ?

C’était vrai ça d’ailleurs ! De quoi elle se mêlait la blonde ? Elle n’avait pas écouté ce que Ninon venait de dire car envoyer Rachel droit dans ses bras pour danser était de loin la meilleure idée pour la faire fuir à « l’autre bout du monde, voire pire ! »
Néanmoins, quand Ninon se tourna vers Rachel pour commencer à essayer de se défendre aussi bien que le lui permettraient les fraises, elle remarqua que cette dernière avait déjà les yeux fixés sur elle et semblait la questionner du regard.
Elle n’avait pas dit non, mais elle n’avait pas dit oui non plus… Dans tous les cas, elle n’avait surtout pas dit non !

_ Bhin… Enfin… Je… Mais… Que…

On développe Nini Chérie, on développe ! Il était vrai que l’idée de se déhancher au rythme d’une musique de ‘jeuns en compagnie de la rousse était tout à fait séduisante, même si dangereuse puisque Ninon aurait du mal à se porter garante de ses écoulement sanguins en provenance de son nez…
Et pourtant, elle s’imaginait déjà telle Baby s’abandonnant corps et âme dans les bras de Johnny (Dirty Dancing). Mais que choisir ? Une valse romantique ? Un tango sensuel ? Un rock acrobatique ou bien un swing effréné ?
Bouarf, le mystérieux DJ globetrotteur trouvera forcément quelque chose pour, au choix, ajouter sa touche  au sentimentalisme du moment, ou bien au ridicule des protagonistes.
Ninon rougit avec un début de sourire qui ne voulait pas dire non.

_Enfin, c’est-à-dire qu’on n’a pas l’occasion de faire valser une jolie redingote tous les jours…

Elle abandonna finalement ses fraises en déposant le précieux gobelet sur la table. Elle laissait enfin tomber sa quête effrénée des dernières semaines après un fruit ridicule et trompeur, pour pouvoir tendre ses mains, maintenant libres, vers Rachel et l’emmener sur la piste de danse d’un pas sautillant rythmé par le froufrou de ses jupes qui s’ajoutait au bruit de la musique.
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Kaede Kobayashi
Élève à l'Institut Gamma
avatar

Messages : 288
Date d'inscription : 04/03/2013
Age : 27

MessageSujet: Re: Halloween Night {Libre}   Mar 13 Jan - 23:59

Le cursus normal. C'était un peu l'inconnu pour l'instant pour moi. Non pas que je ne savais pas ce que c'était mais que j'avais tellement de choix. Je n'avais encore jamais réfléchit à quoi faire après. Devenir docteur ? Policière ? Infirmière ? Un métier dans un bureau ? Dans un zoo... J'en savais rien. Mon avenir à long terme était un peu floue en faites.

- Réinsertion ? Tu veux te réinsérer dans quoi ?

Bonne question ! Un brin dérangeante cependant. Je voulais pas avoir l'air de la psychopathe de compagnie. Alors bon, que pouvais-je répondre ? Me réinsérer chez les être humains ? En Amérique peut être ? Non...

En faites c'était bien plus grand. Je me réinsérer dans la vie tout court. J'avais passé 14 ans dans un trou sans vie hormis les morts que je provoquais et les douleurs que l'on m'affligeait, avec une éducation et une transmission des savoirs réduites au minimum nécessaire. Donc oui, c'était clairement apprendre à vivre normalement en faites que je faisais.

Donc la réponse fut toute trouvée, et je passerais pas pour une folle. Au pire pour une philosophe !

-Je me réinsère à la vie figure toi. Dit je en souriant et prenant une gorgée de jus de raison sucrée. Qu'est ce que c'est bon ! Y a qui mette de l'eau dans leurs vin... Quel bande d'idiot ! Enfin le vin c'est du jus de raisin presque. J'en avais jamais goutté à vrais dire. Donc la pour moi je buvais un vin très sucrée et pas alcoolisée.

Quand à Ninon, c'était de l'histoire de l'art. Et surtout, le plus étonnant étant qu'elle savait déjà ce qu'elle voulait faire plus tard. Je n'en avais aucune idée et cela me ramener sur cette question. Que vais je devenir plus tard ? Quel est ma place dans ce monde ? Après tout... J'ai 24 Ans !

Alors que j'allais lui servir un jus d'orange, Ninon prononça alors une suite de mot des plus étranges.

Une armée de Japonaise ?

Nobody avait raison, il fallait arrêter le ponche pour elle.

-Han mais oui ! Une armée de japonais ! Kaede, tu vas souvent dans les musées dis ? Parce que tu pourrais être la première de mon armée, et comme tu es rousse, tu pourrais être Générale ! Alors, qu’est-ce que tu en dis ?

Woaaaah woaah woaaaah qu'est ce qu'elle raconte ? Pourquoi une armée ? Pourquoi génrale ? Pourquoi rous... non ça je sais. Je me contentais alors de la regarder avec une certain étonnement en essayant de comprendre.

- Mes soldats curieux et ébahis auront besoin d’un leader charismatique et ton air mystérieux derrière ton masque te désigne directement pour ce poste !

Ah oui quand même. Finalement c'était pas une mauvaise idée le masque. Bon, je me décidais du coup à rentrer dans son jeu. Cela m'avait l'air drôle. Moi, chef d'une armée de japonais !

- Aller ! C'est partit ! Mais on va conquérir quel pays ?

Nobody sembla elle aussi entrer dans ce petit changement de rôle qui ressemblait maintenant fortement à une partie de risk. Mais sans les pions.

Cependant, elle fut réfutée de l'armée dès le recrutement. Motif : Blonde et je cite "Ne fait pas saigner du nez". Parce que les autres lui font saigner du nez ?

-Euh ça veut dire quoi que ça te fait pas saigne du n..

Je n'eut pas le temps de terminer ma phrase que la blondinette continuait.

-Et flûte, j’avais dit que les fraise c’était fini… Bon, c’était la dernière… De toute façon, j’ai pas d’chance avec les rousses… ni avec les autres parce qu’il a suffi que je dise à une brune que je l’aimais pour qu’elle fuie à l’autre bout du pays… Alors que je l’aimais pas comme j’aime les rousses, Jade je l’aime comme ma moitié d’orange, c’est ma cachette secrète à bonheur !

Han c'était elle ! Celle avec qui Jade partage sa chambre. Jade m'en avait déjà parlé, mais étant trop occupée à régler mon soucis, j'en avait fait abstraction. La maintenant, je sais qui elle est. Et j'avoue qu'une pointe de jalousie naissait d'un coup dans mon cœur. Sa moitié d'orange ? Hun... Moi aussi je voulais être sa moitié d'orange... ou de pomme ou de n'importe quel fruit d'ailleurs.

- Alors je ne peux définitivement pas dire aux rousses que je les aime, sinon elles changeraient certainement de pays… Voir pire encore !

- Mais tu vient pas de dire que t'aimes les rousses justement, et je suis toujours la.

… Pourquoi je parlais de rousse déjà ? … Ah oui, les fraises ! C’est bon quand même.
Et vous saviez que Rachel fait de la pâte d’amande délicieuse? Elle fait une sorte de prière avec les mains jointes et quand elle les rouvre, il y a de la pâte à l’intérieur.  Si si c’est vrai, même qu’elle m’en a donné. C’était parce que je pleurais… Mais les rousses me vont pleurer aussi.


Oh mon dieu, je réalisait à qu'elle point je devait être déstabilisante que je le faisait aussi. Elle était en mode moulin à parole. Bon essayons d'analyser. Les pâtes d'amande de Rachel, qui n'aime pas ? Les rousses la font pleurer ? Elle doit être sensible.

- NBD, t’es la préposée aux alcools.

Wouah je l'avais pas vu revenir, trop absorbée par le flot de parole qui défiait le mien. Elle avait pas l'air des plus détendue. Il s'ensuivit un échange digne des films d'hommes d'affaires pour la garde des alcools. Nobody était d'accord si la blondinette dansait avec Rachel et une table. Marché conclue.

Ninon en fut toute abasourdie.

- Bhin… Enfin… Je… Mais… Que…

-Ahah ! Tu dit plus rien n'est ce pas ! Tu vas pouvoir aller saigner du nez du coup ! dit je sans en comprendre le sens. J'avais simplement repris l'expression que je trouvais drôle. Je ne m'étais donc pas rendu compte de la bétise que je venais de dire. De toute façon elles étaient partis danser.

Je regardait Nobody en haussant les épaules.

- Bon et bien, je te propose de t'aider !

Il fallait alors trouver une table libre ou en libérer une, faute de place. Rachel avait visiblement prévue la chose, il y avait largement assez de place. J'en pris une avec Nobody et l'aida à l'installer le temps que les deux autres dansaient au milieu des autres couples sur la musique de circonstance.

Le punch fut evidemment la cible numéro UNO de Nobody, cependant, elle avait aussi son matériel. Je fut préposée pour faire le check des boissons pour savoir si elles étaient alcooliser ou non. Hors de question de boire. La technique ? Renifler !

Si je grimace c'est que c'est alcoolisé, sinon c'est sécurisée.

Ainsi, tous les punchs étaient grimaçant, certain moins que d'autre, et une fausse alerte a cause d'un jus de pamplemousse, qui m'a fait grimacé d'amertume. J'était un bon détecteur d'alcool en faites. Bon, tous le monde aurait pus le faire, ce n'était pas un exploit. Une fois terminée, je tournais mon attention sur le petit nouveau, John.

- Alors John, tu parles beaucoup dit donc. Tu es en quel classe toi ? Nobody t'embète pas trop ? dit je ensuite en tirant la langue à Nobody.

- Surtout qu'elle change tous le temps d'apparence, on la reconnait jamais hi hi hi !

J'attendais alors la réponse de John tandis je regardais du coin de l’œil les deux danseuses.

Oui j'avoue que j'étais ENCORE un peu jalouse. Ninon avait Jade et maintenant elle avait Rachel... tseuh.  C'est vraiment trop'injuste comme disait un drôle d'oiseau noire avec une coquille d’œuf sur la tête.

_________________
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Echo
X-Men Oméga
avatar

Messages : 1011
Date d'inscription : 10/05/2012
Age : 23

MessageSujet: Re: Halloween Night {Libre}   Ven 16 Jan - 16:00

Nobody était assez amusée de la discussion, nullement déstabilisée à l’inverse de John qui regardait les deux autres avec des billes dignes de cartoon tout en restant au plus près de la personne qui semblait la plus normale du lot, ce qui n’était d’ailleurs absolument pas normal. En tout cas elle semblait bien partie pour un nouveau Nobody’s Show après cette soirée, même si Rachel ignorait si elle avait enclenché l’enregistreur de son téléphone ou non, lequel se trouvait dans une poche de son pantalon. En tout cas, l’Echo interrompit Ninon dans un monologue dont le sujet lui avait majoritairement échappé, contrairement aux deux autres, qui ne s’était pas arrêté avant malgré toutes les tentatives de Kaede, donnant l’occasion à l’ainée de toute de mettre son grain de sel au détriment de la majorité.

- Plait-il ?

- Euh…

L’idée lui plaisait-elle ? C’était une excellente question, même si elle n’avait rien contre ; juste de la perplexité sur plusieurs points. Les buts de Neassa étaient assez clairs, faire le plus incongru mais divertissant possible tant pour elle que pour les autres et le fait d’envoyer une traumalcoolisée dans les bras de ce qui était en phase de devenir un fantasme courant dans l’Institut ne pouvant sans doute qu’apporter à cela. Maintenant, restait à déterminer si Ninon le voulait vraiment et si elle était capable de danser sans finir parterre ; et ça c’était tout de suite plus difficile à voir.

- Bhin… Enfin… Je… Mais… Que…

- Ahah ! Tu dit plus rien n'est ce pas ! Tu vas pouvoir aller saigner du nez du coup !

Rachel tourna le regard vers Kaede et se renfrogna. Il était vrai que Ninon avait déjà saignée du nez sans raison apparente, une ou deux fois en sa présence, mais cela lui passait l’envie de la danse du coup ; d’un « pourquoi pas » on passait à un « vaut mieux pas » pour le coup. L’Echo ne craignait pas un mauvais geste, non, juste que cela lui serait plutôt désagréable.

- Enfin, c’est-à-dire qu’on n’a pas l’occasion de faire valser une jolie redingote tous les jours…

Rachel déglutie ; si c’était juste faire valser la redingote elle pouvait la lui prêter. La musique commença plus doucement que la précédente mais fut suffisante pour que Ninon entreprenne de la prendre dans les mains et la trainer vers le centre du gymnase, l’Echo résistant un instant avant de se laisser faire ; le temps d’un simple échange mental avec Neassa. Cette dernière hocha la tête puis les regarda partir alors que sa partenaire à elle semblait déjà partie aussi alors même que seule la moitié du contrat avait été remplie par l’autre partie.

I'll Go Crazy If I Don't Go Crazy Tonight by U2 on Grooveshark

- Bon et bien, reprit la Cornue après un haussement d’épaule et à l’intention de Nobody, je te propose de t'aider !

- Merci Kaede, juste une chose : tu as suffisamment dû côtoyer Rachel pour comprendre qu’aucun mot n’était innocent avec elle, alors fait gaffe à ce que tu dis la prochaine fois.

Ce n’était pas dit comme un reproche mais plutôt un avertissement, même si elle n’était pas certaine que celle à qui elle l’ait adressé y ait accordé la moindre attention, déjà partie dans son idée du bien faire. Sans doute dû à son passif, ce qui était plus souhaitable qu’à son caractère, mais en plus de sa maladresse Kaede semblait se contenter de la superficialité, ne cherchant à comprendre ou à voir au-delà de ce qui lui était montré ; un défaut qu’ils étaient beaucoup à avoir mais qui pouvait faire du dégât. Otant son casque d’une seule main, Nobody le déposa sur la table alors que de l’autre elle portait son verre en plastique à ses lèvres, laissant tout le soin à Kaede d’évider la table derrière elle où se trouvait l’incriminé. Baissant le visage simultanément au gobelet, elle posa son regard sur John qui ne la quittait plus des yeux et lui sourit. Il ne lui rendit pas son sourire mais continua de se proposer de tenir son gobelet le temps qu’elle s’occupe de ce qu’elle devait faire, une chose que sa « coéquipière » était manifestement déjà en train de faire seule et d’une drôle de façon. Elle était sérieuse ? Kaede, Saint-bernard de l’alcool ? Se passant une main dans les cheveux, Nobody prit parti de faire ce qu’elle avait toujours fait : en rire ; outre que cela ne serait pas des plus efficaces puisqu’il suffisait d’une boisson acide pour faire grimacer la Cornue, celle-ci semblait aller un peu vite en besogne comme si l’objectif était d’avoir fini avant que la chanson ne se termine. A moins que ce ne soit la danse…

Danse qui commençait doucement, l’Echo c’étant laissé embarquer mais n’étant pas des plus aisées avec l’idée d’implication de son conditionnement. Elle en serait presque venue à souhaiter que Ninon ait suffisamment d’alcool dans le sang pour en changer l’odeur mais n’y croyait absolument pas, tant à ce que la française soit bourrée à un tel point qu’à ce que ça soit possible. Du fait, Rachel était plutôt tendue ; la danse n’était pas quelque chose de compliqué, c’était du n’importe quoi mais du n’importe quoi en rythme. Le n’importe quoi elle connaissait et à défaut d’avoir le sens du rythme personne ne lui reprocherait ; surtout considérant que la plupart ne l’avait guère plus et que peu étaient ceux à s’oser à plus que simplement se secouer.

La rousse prit ses appuis une fois que Ninon l’eue placée à où elle le voulait, entreprenant de bouger avec un minimum de synchronisation avec sa partenaire même si son attention allait moins à cette dernière qu’à son réseau sanguin. Elles avaient loupé le début mais cela ne lui posait pas tellement de problème, le rythme moins effréné que précédemment. Elle leva l’un de ses bras lorsque Bono commença à crier, soutenant la montée du fait que ce n’était pas une colline mais une montagne et entreprenant de lever le second du fait qu’elle commençait la montée, elle aussi, continuant de s’étirer autant qu’elle le pouvait à la question et le maintient de la voix sans pouvoir pour autant se mettre sur la pointe des pieds, talons restreignant. Le chapeau aussi l’emmerdait, moins que le stress de voir Ninon se laisser échapper du liquide carmin mais tout de même, ainsi alors que le rythme s’accélérait elle hocha la tête pour le suivre et se débarrasser de l’heaume au passage.

La musique ne tarda pas à se ralentir avec de nouvelles paroles concernant bien plus les gens de l’Institution qu’ils ne s’en rendraient compte et plus qu’en profiter pour se rapprocher de Ninon l’Echo shoota dans son chapeau pour l’expédier avec sa précision habituelle à destination de Neassa et de la table qu’elles avaient dégagée pour mettre l’alcool. Tapant du pied au rythme de la batterie tout en avançant et reculant le buste à celui de la guitare, Rachel prit les mains de la française pour lui faire tenir le rythme également, ne la lâchant que lorsqu’il fut de nouveau question du refrain pour accomplir à nouveau ce qu’elle avait déjà fait précédemment, chapeau en moins.

Puis elles en arrivent à une nouvelle partie et alors que Bono répétait son mot Rachel secoua le buste par impulsion de ses épaules, comme si elle courait ou boxait, marquant une pause pour tendre le bras correspondant à l’épaule avancée lorsque le chanteur maintint son mot plusieurs secondes. Puis elle recommencerait, escomptant sur la répétition pour attraper la seconde main de la française et pouvoir entreprendre de sautiller et de la faire sautiller au rythme des hey ! Gardant les mains dans les siennes à la guitare qui suivit, elle tenta de se rapprocher et de s’éloigner à la mesure avant de la relâcher pour reprendre la chorégraphie du refrain, s’adaptant puisque c’était là le dernier et qu’il différait un peu.

Vinrent enfin les derrières paroles et le rythme bien plus doux comme c’était suggéré, où Rachel reprit les mains de Ninon pour bouger les épaules, le torse et les bras de façon plus lente et douce là-aussi. La technique de Nobody avait fonctionné, elle c’était laissée aller purement et simplement et son appréhension comme son éventuelle faim face au saignement nasal n’avaient pas gâché le moment même de la danse ; en revanche, si Ninon avait effectivement saignée, l’Echo n’aurait pas laissé beaucoup de temps à la conclusion de la musique avant de la laisser sur place et de se diriger vers son amie et ce qu’elle était sensée avoir réuni ; quelques amuse-gueules du buffet pour tenter de combler le commencement de faim.

Neassa Boadicée Dorian avait-elle un plan ou improvisait-elle au fur et à mesure ? C’était difficile à dire et jamais elle-même ne l’avouerait sur le bon principe « une magicienne ne révèle jamais ses secrets ». Toujours était-il qu’elle avait une certaine expertise dans le rattrapage de conneries d’autrui et que plus qu’assurer sa part du contrat en tentant d’expliquer à Kaede qu’il y avait d’autres choses qui pouvaient piquer le nez mais que le bar était sensément sans alcool même si les élèves majeurs étaient en droit d’apporter leur consommation, et qu’il était plutôt improbable que quelqu’un se soit amuser à foutre de l’alcool dans toutes les boissons en saladier qu’il y avait, sachant que ça n’était pas non plus la majorité puisque les bonnes vieilles bouteilles et briques restaient la valeur la plus sure et qu’il était improbable que Rachel n’ait pas perçue une personne s’amusant à y introduire de l’alcool considérant ses capacités de surveillance. La gestion de l’alcool consisterait plus, du fait, à trouver les bouteilles et autres qui trainaient pour soit les ramasser lorsqu’elles semblaient sans propriétaire soit les laisser sur place lorsqu’elles accompagnaient des affaires et étaient donc clairement identifiées ; le vol d’alcool était à la responsabilité du propriétaire et du voleur, pas la leur. Chose n’empêchant pas que Nobody demander, lorsque c’était possible, si lesdits propriétaires ne voulaient pas s’en délester pour remplir le « stand » ; chose qui surtout prendrait plus que cinq minutes et motivait donc qu’elle reste auprès de la table d’alcool qui semblait destinée à devenir leur QG une fois le tour du buffet fait et les quelques amuse-gueules pour Rachel, voir pour d’autres, réunis.

- Alors John, tu parles beaucoup dit donc. Tu es en quel classe toi ? Nobody t'embête pas trop ? Surtout qu'elle change tous le temps d'apparence, on la reconnait jamais hi hi hi !

- C’est mieux que la chirurgie esthétique et ne plus avoir à dormir sous injection de tranquillisant me fait un bien fous, réplique-t-elle en prenant la pose, une main sur le flanc et l’autre portant son gobelet, rendu par John dès qu’elles s’en étaient revenues à attendre les deux autres, à ses lèvres.

Après un regard à sa chaperonne, le garçonnet entreprit de lever sa main libre à direction de Kaede, non comme un enfant l’aurait fait avec une fierté puérile mais avec toute la retenue d’une personne n’ayant que cela pour s’exprimer, avant de replier son pouce.

- 4e Grade. Le seul de l’Institut ; c’est Xavier qui s’occupe de son enseignement. Je l’embête pas plus que les autres et il ne parle que lorsqu’il est en confiance.

Voyant Rachel, et surement Ninon à sa suite, revenir, Neassa se servie de sa propre main libre pour prendre le plateau d’amuse-gueules récupéré et le tendre au cas où la française ait déclenchée la faim de la britannique d’adoption, avant soit de laisser cette dernière se débrouiller avec soi de le faire passer. Elle reposa son gobelet ensuite pour reprendre son casque et se le passer sous le bras.

- Bon, excusez-moi les gens mais Magnécoco doit aller faire la quête des boissons alcoolisées. Je reviens avec le butin et j’exigerai une danse en paiement, vous avez le temps de vous faire passer la bombe en attendant que mon retour.

_________________
Phénix

"Des monstres ont fait de moi un monstre,
Des divinités ont fait de moi une divinité,
Seuls les humains peuvent faire de moi une humaine."






731 Posts Rp
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Ninon Lenoir
Élève à l'Institut Beta
avatar

Messages : 243
Date d'inscription : 09/07/2014
Age : 24

MessageSujet: Re: Halloween Night {Libre}   Lun 19 Jan - 11:09

_ Aller ! C'est partit ! Mais on va conquérir quel pays ?

Quel pays ? QUEL PAYS ? Oh mais ça n'allait pas du tout, il fallait apprendre à voir grand dans la vie, beaucoup plus grand. Ninon se colla un petit post-it mental entre deux fraises pour en toucher quelques mots à son futur grand général, une fois qu'elle aurait décuvé et que ses idées se seraient éclaircies. Un pays c'était trop peu... Il fallait conquérir le monde et plus encore car l'art méritait d'être connu partout autour du globe et non de n'être réservé qu'à une élite de bobos dans des vernissages aussi pompeux que ridicules ! Levez vous braves citoyens du monde ! A vos carnets et tous aux musées ! L'art au peuple ! VIVE LA REVOLUTION !
Quand les sans-culottes s'insurgeaient pour prendre d'assaut la Bastille, la sans-soutif elle, s'insurgeait pour mener la population mondiale au musée.
Jésus Marie Joseph, ces fraises !

_ Mais tu vient pas de dire que t'aimes les rousses justement, et je suis toujours la.

Était-ce parce qu'elle avait les cheveux rouges et non orangés, ou bien qu'elle était simplement immunisée à la roussophilie abusive de Ninon ? Dans tous les cas, elle était effectivement là... Brave et fidèle Général, les pages de notre histoire s'écrieront dans la passion, le sang et les larmes! De plus, la française ne saignait pas du nez et elle n'avait d'ailleurs pas de petits cœurs dans les yeux... Pas que la japonaise soit vilaine à regarder, bien au contraire, mais les pics de sa pathologie ne devaient arriver que sous certaines fréquences bien précises du spectre lumineux. Ou alors les fraises y étaient pour quelque chose (encore elles!)... Il faudra en parler à Jade pour faire faire un peu d'exercice à son gros QI !

_ Ahah ! Tu dit plus rien n'est ce pas ! Tu vas pouvoir aller saigner du nez du coup !

Malheureusement, ou heureusement, ces saignements intempestifs n'arrivaient pas sur commande ! D'ailleurs, s'ils arrivaient sur commande ils ne seraient plus aussi intempestifs... Par contre, sans être prévisible à 100%, ils étaient programmables lorsque l'on savait ce qui les provoquait.

Bref, alors que Kaede reniflait avec suspicion tout ce qui passait à portée de ses narines pour tenter de déceler les breuvages alcoolisés avec autant d'efficacité que le lui permettait son masque, Ninon se prenait pour Cendrillon au balle en continuant de tirer sa belle « Officier » au milieu de la piste de danse pour l'y faire tournoyer jusqu'au bout de la nuit.
Belle « Officier » qui avait commencé à vaguement résister quand Ninon lui avait attrapé la main, mais qui s'était finalement plutôt rapidement laissée faire, car après tout, comment résister aux charmes d'une charmante Nini aussi gaie qu'enthousiaste à l'idée de vivre l'un des moments les plus romantiques de son existence ? Les joues rouges, les yeux brillants et le cœur qui palpitait, rien n'aurait pu résister à cette vague irrépressible d'amour et de félicité.
Les premiers pas de danse avaient été plutôt crispés de la part de la rousse qui peinait à se détendre et qui semblait se mouvoir avec une énorme gêne localisée dans son fondement.
Alors bien sur, ce n'était pas la valse passionnée dont Ninon avait rêvé, les mouvements étaient moins souples, plus hasardeux, plus conceptuels. Mais rien n'aurait pu entacher son bonheur.   Elle sourit à sa cavalière en l'imitant et en ajoutant cependant des mouvements à sa danse minimaliste pour l'inviter à se détendre, même si la cause de son stresse n'était pas forcément celle à laquelle elle pensait.
Après un trépignement timide des pieds et quelques changement d'appuis aléatoires plus ou moins au rythme de la musique, Rachel commença à innover en faisant entrer ses bras dans la danse. Elle les leva, l'un après l'autre, jusqu'à virer son chapeau pour l'envoyer valser plusieurs mètres plus loin d'un simple coup de pied.
Elle prit ensuite l'initiative d'attraper les mains d'une Ninon aux anges et dont le visage ne pouvait être plus radieux. Elle suivait ses mouvements au rythme de la musique, en la faisant tournoyer sur elle-même par moment. Tâche relativement compliquée vu la différence de taille notable des deux partenaires, et qui exigeait que Ninon se tende du mieux qu'elle le put sur la pointe de ses pieds nus, jusqu'au bout de ses doigts pour que Rachel arrive à passer sa tête sans faire trop de gymnastique. Les deux jeunes femmes sautillèrent, les mains dans les mains, ce qui rappela au passage à Ninon que les sautillements sans sous-vêtements n'étaient pas à recommencer tous les jours si elle voulait continuer à mettre des hauts comme ceux de ce soir sans avoir à rougir, autant au niveau des sensations présente que des formes futures.
Rougir ! Fraises, proximité avec Rachel ou danse effrénée ? Les trois en même temps ? Dans tous les cas, les joues de Nini ne se séparèrent pas de leurs jolies couleurs, tout comme ses lèvres de leur sourire et ses yeux de leurs étoiles. Sans compter qu'aucun saignement n'avait encore pointé le bout de son nez, ce qui était tout bonnement miraculeux, surtout à la vue de sa jolie rousse dont les mouvements n'avaient cessé de gagner en naturel.
Toujours en suivant les notes de la musique, Rachel avait ralenti ses pas pour plus de douceur et de sensualité, ce qui augmenta les rougeurs de Ninon dont les gouttes de sangs commençaient finalement à perler sous sa narine pour descendre, aussi lentement que les nouveaux mouvements de Rachel, vers sa lèvre sans qu'elle ne s'en aperçoive. Ce fut à ce moment là que le morceau se termina et que la rousse fuit littéralement la piste de danse, laissant la traumalcoolisée seule au beau milieu d'une foule surexcitée qui commençait déjà à se déhancher à nouveau au son des battements des basses qui se faisaient entendre.

_ Bhin... ?

Perdue et abandonnée, son visage s’attrista et son sourire s'effaça immédiatement alors qu'elle la regardait partir. Elle baissa la tête sans comprendre. Pourtant elle n'avait pas fait mention de son affection, elle n'avait même rien dit puisqu'elle n'avait fait que sourire et danser. Mais Rachel s'était quand même enfuie au pas de course prédit un peu plus tôt.
Les larmes aux yeux et plus malheureuse encore que Cendrillon qui venait de perdre sa chaussure (car en plus elle n'avait même pas de chaussures), Ninon regagna tristement le buffet où Rachel s'était jetée sur les petits fours, lui brisant le cœur une nouvelle fois puisqu'il semblait qu'elle avait trouvé la pâte feuilletée industrielle de chez Picard plus appétissante qu'une française arhumatisée à la fraise.
Elle prit place à côté de Kaede en émettant un petit reniflement pour ravaler ses larmes.

_ Il y a quelque chose sans fraises mon Général ?

Même avec moitié moins de discernement qu'à l'ordinaire, Ninon avait bien compris que le jus des fruits n'aidait pas à avoir les idées claires... Et qu'il valait mieux, du même coup, les éviter.

_ Bon, excusez-moi les gens mais Magnécoco doit aller faire la quête des boissons alcoolisées. Je reviens avec le butin et j’exigerai une danse en paiement, vous avez le temps de vous faire passer la bombe en attendant que mon retour.

_ T'façon moi j'danse plus, c'est nul. Après un nouveau petit reniflement, Ninon décida de s’accroupire à côté de John en lui souriant gentiment plutôt que d'ailler bouder dans son coin. Et toi ça va mon p'tit lapin, tu ne t'ennuies pas trop ? Moi à ta place, je m’ennuierais ferme, les grands c'est bête et pas très drôle.
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Sanzo Aoe
Élève à l'Institut expérimenté(e) Delta
avatar

Messages : 1105
Date d'inscription : 03/11/2012

MessageSujet: Re: Halloween Night {Libre}   Mer 21 Jan - 10:58

(one shoot)

(31 octobre 2014 - toit du gymnase)

Comment peuvent ils ? Comment peuvent ils s'amuser autant après tout ce qui s'est passé, il y a un 1 mois. 1 mois, toute une vie. 30 longs, très longs jours. 32 exactement. Combien d'heures ... j'en sais rien, je suis nul en calcul ... surtout aussi absurde. Jade saurait surement.
Halloween la pire fête de l'année, de cette année. Dire que dans deux mois à peine ça sera noel ... J'ai pas encore décidé si je rentrais ou pas. En tout cas je ne souhaite pas fêter mon anniversaire, pas cette année. Il n'y a rien de joyeux ou glorieux à prendre un an ... J'en aurais 19 mais serais je plus vieux, plus sage, plus mûr ... non ... Ce ne sont pas les années qui font murir mais les épreuves.
Halloween, la fête des morts, mais les morts se fichent bien de nous. Ils sont morts. Enterrés, brulés, noyés ... découpés en petit morceau ... comment pourraient ils penser ? Sentir ? Ressentir ?
Une fois mort il n'y a plus rien. Plus rien du tout à par la peine du survivant ... je le sais. J'en sais quelque chose. Aujourd'hui je sais ce que veut dire "mourir". Il ne reste plus rien sauf un corps froid et immobile. Un corps mou qui ne ressent plus rien. Je l'ai tenu dans mes bras si longtemps que je sens encore son poids. J'ai encore son odeur dans le nez et son visage pale devant les yeux et pourtant ...
Halloween et ses déguisements ... quelle idiotie ... quel intérêt à se déguiser en monstre ... nous le sommes 365 jours / an, 24h/ jour ... chaque minute, chaque seconde ... chacun d'entre nous est déjà un monstre. Pas besoin de fêter ça. Il n'y a rien de glorieux à être un monstre et encore moins à être ce qu'on est pas.
Je les observe et ils rient, ils s'amusent. Je reconnais certaines personnes ... la plupart en faite malgré leurs déguisements étranges ou curieux.
J'ai repéré Rachel qui circule de groupes en groupes, à parler à tous, m'a-t-elle repère ... surement mais du moment qu'elle me laisse tranquille je m'en fiche De mon perchoir je les observe par une des nombreuses lucarnes. Bon je sais c'est interdit mais franchement c'est le dernier de mes soucis. Elle est la seule à pouvoir me voir. Je trouve son costume bizarre ... mais très Rachelien. Elle mange ... ou met elle toute cette nourriture ? ... qu'importe c'est Rachel ... elle pourrait envoyer ses kilos en trop sur la lune ou n'importe où si elle le souhaitait.
... Sean est enfin arrivé. Il est le seul à avoir voulu se joindre à la fête. On ne s'était pas beaucoup parlé depuis et un Sean muet c'était ... dérangeant en fait. Il a parfaitement récupéré de sa blessure mais ses pouvoirs ont muté. Il part rapidement dans les ultra sons ... un peu trop rapidement pour mes oreilles d'ailleurs. Irina a dit que c'était un effet secondaire et que les choses reviendraient à la normale avec le temps ... j'espère ... Lui il s'en fiche. Il me l'a dit. Au contraire il trouve ça "cool". C'est Sean ... Je crois que rien ne peut avoir d'emprise sur lui ... quelle chance. Il ne m'a rien demandé, ça m'a énervé sur le moment ... meme si de toute façon je ne lui aurais rien dit. J'ai rien dit à mon père, j'ai pas dit grand chose à Amy ... alors ... et pourtant il est mon meilleur ami. C'est curieux car je me sens étrangement proche de lui, encore plus qu'avant ...
Son déguisement ... s'il a voulu jouer les sosies de Marylin Manson c'est réussi ...
Tiens Ninon ... je ne pensais pas qu'elle viendrait ... son engouement pour les rousses l'a donc fait sortir de sa tanière. Comment prend elle le départ de Jade ? Bien d'après ce que je vois. Son costume est ... étrange. Elle ne ressemble pas à Ninon. Je l'aurais plus vu avec une grande robe en mousseline et une couronne sur la tête ... Des fraises ... sacrée Ninon ... heureusement qu'il n'y a pas de champagne ...
Sympa ce costume de ninja girl ... je ne connais qu'une personne avec des petites cornes ... Kaede ça fait un moment que je ne lui ai pas parlé ... est ce moi ??? c'est étrange d'etre là à les regarder, tous ces gens que je côtoie au quotidien, que je connais ... mais les connais je vraiment ?
J'ai l'impression de n'avoir fait que les survoler.  Quel intérêt je porte aux autres ... Suis je comme mon père : superficiel ? Est ce que tout ces gens m'importent ... m'importent vraiment ?
En temps normal j'aurais dit oui mais aujourd'hui ... j'en sais rien, vraiment rien.
Cait était prête à tuer tout le monde, moi y compris ... alors comment je pourrais savoir ...
est ce qu'un jour j'aurais aussi cette envie ?
Brrrr,  il fait froid sur ce toit, enfin il ne pleut pas. C'est pas confortable, c'est pas agréable. Est ce ma punition ? Dois je me punir de ne pas l'avoir sauvé ? D'etre si faible ?
J'ai envie de hurler ... et toi la lune tu m'entends ?  ... et vous étoiles qui brillez est ce que vous me comprenez ...
Peut être que si je me transformais tout serait plus facile ... ne plus penser, ne plus ressentir ... sauf que je n'y arrive meme pas ... Il n'y a rien de joyeux ces derniers temps et je ne suis meme pas en colère ... après qui ... ces tarés qui se cachent pour commettre leur méfait ? Ces politiciens qui ne savent que parler et agir après coup ? Quelle importance que se soit les Confréristes, le Mouvement de libération des mutants ou la guilde des vers de terre, ils ont tué pour rien ... rien n'a changé et rien ne changera jamais.
J'avais pas compris ce que me disait Caitlyn ... D'ailleurs il faut que je refasse mon compte rendu. Je vois les choses différemment aujourd'hui. Il n'y a ni bon ni mauvais choix, mais juste un choix. Une décision à prendre en quelques centièmes de seconde. Un choix qui influe sur tout une vie, un choix qui change non seulement une vie mais aussi celle de tous ceux qui gravitent autour de soi. Mes décisions l'ont poussé à faire des choix qu'elle n'aurait pas eu à faire et à son tour ses choix ont influencé les miens ... Est ce ça la vie ... vivre en société ...
tiens Ninon est triste  ... pauvre Ninon toi aussi tu te brules les ailes à la flamme du Phénix. Rachel est impossible à capturer ... et puis n'est elle pas plus belle ainsi ? Aussi libre que l'air ...
Je me demande qui est ce petit garçon ... il me dit vaguement quelque chose ...
réfléchi ...
ha oui ... encore un truc douloureux ... comment j'ai pu ne pas le reconnaître. Je me demande ce qu'il fait ici. D'un autre coté, il est bien mieux là. Il n'a plus personne comme tant d'autres.
Mmmm je  ne vois pas Charlie, mon coloc n'a pas voulu venir ... est ce qu'il est au courant au moins ... Il aurait fait un malheur en guitariste trash ...
J'aurais du prendre une couverture ...
je me demande ce qu'elle fait ... pense t elle à moi ? S'inquiète t elle ?
D'un coté ça me plairait mais ... elle doit vivre pour elle, pas pour moi. Ou est la limite ?
Et père ... je m'inquiète aussi pour lui. J'espère qu'il ne va pas faire de bêtises ... que Karl va réussir à le tempérer ...
A t il vraiment compris ce que je lui ai dit, surement mais il est si têtu. S'il lui arrivait quelque chose par ma faute, je ne me le pardonnerais pas.
Bon ... décidément cette soirée n'est pas réjouissante et je suis gelé.


D'un bond leste, Sanzo se lève et descend rapidement du toit. Un dernier regard au gymnase d'ou s'échappe de la musique. Non décidément Halloween n'était pas une fête.

_________________

Nombre de rp  cat 
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Kaede Kobayashi
Élève à l'Institut Gamma
avatar

Messages : 288
Date d'inscription : 04/03/2013
Age : 27

MessageSujet: Re: Halloween Night {Libre}   Jeu 22 Jan - 23:32

Roulement de tambour et résultat des courses ?

1... Un seul autre verre était effectivement remplit d'une substance un peu plus corsée que les autres.

J'avais grimacé pour du jus de pamplemousse, du jus de pomme, du coca-cola (ne me jugez pas s'il vous plait, y avait pas beaucoup de lumière et les bulles ça pique !) et un jus de tomate. Rien de très alcoolisé au final et un bon foutage de gueule de la part de Nobody. Bon c'était méritée. Elle parla aussi à la place de John. Vraisemblablement, ce petit était bien plus timide que ce que je pensais.

Moi qui me met à parler sans cesse quand je suis stressée, pour lui c'était tout l'inverse. Je me contentais alors d'un sourire vers lui le plus bienveillant que je puisse faire.

- Et bien je suis ravie de te rencontrer.

Je lui fit alors une petite courbette à la japonaise, comme une poignée de main, mais bien moins intrusif. Et c'était en même temps pour entrer un peu plus dans la peau du personnage. Après tout, je suis une ninja !

- Il y a quelque chose sans fraises mon Général ?

Whoop, je fit un volte-face un peu brusque, surprise par la voix de Ninon soudainement derrière moi. Avec tous ça, je n'avais pas vu la fin de la danse de la blonde et la rousse. Et visiblement, j'avais franchement loupé un épisode. Déjà une Rachel en quête de nourriture, cela semblait plutôt normale à ce niveau. Ensuite, une Ninon avec les yeux tous humides, voir larmoyants. Et troisièmement... pourquoi est ce qu'elle saigne du nez ?

Mince, je pensais pas qu'elle le ferait vraiment ! Je comprenais maintenant pourquoi Rachel n'était plus avec sa cavalière. Bon le plus urgent était de trouver quelque chose pour Ninon. Un truc à boire et un surtout truc pour lui nettoyer le nez. Ce qui me surprenait le plus, était que, pour moi, les saignements de nez ne pouvaient être causés que par des coups. Comment un saignement comme ça, pouvait survenir sans prévenir. Ninon devait être terriblement fragile, en tout cas du nez. Peut être avait elle dansé trop fort avec Rachel ? C'est vrais qu'après, la blondinette semble assez frêle. C'était peut être bien le cas.

- Euh... oui.

Je m'empressais donc de trouver quelque chose pour Ninon. Un rouleau de sopalin, prévu à cette effet pour éponger les quelques boissons qui seront renversées au cours de la soirée, était posé la, sur une table voisine et un verre d'eau que j'agrémentais aussitôt de sirop de menthe. J'en profitais alors pour rentrer un peu dans son jeu mais je ne trouvais pas plus haut que général. Je cherchais alors un truc plus haut qui pourrait le commander. Hmmm...

- Je crois que vous avez besoin de soin avant... Euh... Madame l'impératrice. lui dit je en lui tendant le verre d'eau mentholée et deux feuilles de sopalin. C'était certainement stupide mais je n'avais rien trouvé d'autre sur le coup.

Nobody en profita ensuite pour aller réaliser sa quête de l'alcool. La mienne ayant lamentablement échouée grâce à une technique dont la fiabilité n'était plus à prouvée, puisque totalement inexistante. Je veillais donc sur une blonde sanglante légèrement imbibée de larme et d'alcool, et d'un petit bout de chou, silencieux et studieux. Pufff... Je laissais échapper un sourire en scrutant par la même occasion Rachel. Le saignement de Ninon allait s’arrêter et Rachel pourrait être plus tranquille.

- T'façon moi j'danse plus, c'est nul. Et toi ça va mon p'tit lapin, tu ne t'ennuies pas trop ? Moi à ta place, je m’ennuierais ferme, les grands c'est bête et pas très drôle.

- Roh mais non, elle dit n'importe quoi. C'est bien d'être grand. Tu peut faire plein de chose que tu peut pas faire quand t'es petit. Mais bon il faut d'abord apprendre à être "grand" parce que ça vient pas comme ça tout seul. Faut prendre le temps. Moi on m'a obligé à être grande quand j'étais encore petite et c'est pas drôle du tout. Et puis y a pas que des grands ici en plus.

Bon il n'y avait pas des personnes aussi jeune que lui, mais il y avait pas mal de mineurs, adolescent(e)s et pré-adolescent(e)s qui se découvraient des dons de danse ou qui avaient déjà l'habitude. En faites la soirée était sacrement bien animée.

Et je pense que l'on passait déjà un très bon moment.

_________________


Dernière édition par Kaede Kobayashi le Dim 25 Jan - 13:18, édité 1 fois
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Echo
X-Men Oméga
avatar

Messages : 1011
Date d'inscription : 10/05/2012
Age : 23

MessageSujet: Re: Halloween Night {Libre}   Ven 23 Jan - 16:17

Ninon n’avait pas l’air contente, enfin si mais d’un contentement… con. En tout cas, elle avait participée à la danse et tenue seule sur ses pieds comme une grande, rajoutant même de l’imprévu et du compliqué avec sa volonté de faire passer l’Echo et la trentaine de centimètres supplémentaires sous son propre bras ; heureusement qu’il n’y avait plus le chapeau sinon c’était mort de chez mort. Mais ce qui mourra vraiment fut le sourire de la française lorsque la britannique s’en retourna, visage crispé ; le stress de l’attente avait été pire que l’action elle-même, comme souvent, mais n’avait pas été inutile puisque Ninon avait effectivement commencée à saigner, du fait sa faim avait commencée et surtout c’était accompagnée de quelque chose de plus extrême. Que son conditionnement ressorte dans des endroits comme Bleecker Street, en mission lorsqu’elle portait les Marques d’Assermentation des Limiers, c’était une chose mais qu’il vienne dans des instants incongrus comme celui-ci lui donnait l’impression qu’il lui pourrissait la vie.

Arrivée au niveau de Nobody qui l’attendait, la rousse prit le plateau d’amuse-gueule avec un hochement de la tête légèrement trop expéditif pour le remerciement qu’il signifiait puis commença à les enfourner, un à un, comme l’on mange des carrés de chocolats ou du pop-corn.

Let Me Down Slow by The Rolling Stones on Grooveshark

Ninon revient également auprès de la future table à alcool, n’ayant que quelques pas de retard sur elle mais ne lui accordant plus de regard alors qu’il s’humidifiait d’un sentiment la poussant surement à abandonner les fraises. Général, cela fit relever la tête à Rachel qui se tourna un instant vers elle avant de se rappeler qu’il lui manquait le chapeau pour avoir la tenue complète du personnage originel de son costume, qui avait été général également. Néanmoins c’était au Géninja que la Franfraise s’adressait donc Washington Dénudé(e) ne rajouta rien, continuant de remplir sa bouche à répétition en périphérie.

Kaede réagit aussi promptement que sa surprise lui permettait et avec une conviction qui aurait nécessité reprise à l’armée, même si au final elle trouva tant la boisson que l’essuie-tout utiles à l’impératrice… Nini l’Impératrice, ça sonnait bien. Il devait d’ailleurs y avoir une série du genre, dans le temps… mais bon, ça passait après les cubes de jambon et les biscuits pizza. Chacune ses priorités : Nobody allait faire du crime contre les boissons alcoolisées, la Cornue servir la Traumalcoolisée qui en était elle-même à se pencher vers le traumatisé tout court qui voyait sa première chaperonne s’en aller et l’autre qui aurait pu assumer ce rôle déjà occupée avec des trucs « à croquer ».

- T'façon moi j'danse plus, c'est nul. Et toi ça va mon p'tit lapin, tu ne t'ennuies pas trop ? Moi à ta place, je m’ennuierais ferme, les grands c'est bête et pas très drôle.

- Roh mais non, elle dit n'importe quoi. C'est bien d'être grand. Tu peux faire plein de chose que tu peux pas faire quand t'es petit. Mais bon il faut d'abord apprendre à être "grand" parce que ça vient pas comme ça tout seul. Faut prendre le temps. Moi on m'a obligé à être grande quand j'étais encore petite et c'est pas drôle du tout. Et puis y a pas que des grands ici en plus.

- Désolée si je danse mal, Nini, lança Rachel depuis sa position, se sentant parfaitement visée par le fait que la danse soit nulle et qu’elle ait déçue la française qui était plus libre d’esprit que de norme. Juste que le sang… ça m’a stressée.

Etait-il nécessaire d’en dire plus ? Peut-être, peut-être pas, pas ici en tout cas. Elle avait fait cela pour essayer de faire sourire à nouveau, pour essayer non-pas de faire oublier ce qui c’était passé mais de faire vivre malgré tout. Ils n’étaient pas beaucoup à en profiter parmi les personnes qu’elle aurait aimées y voir mais la plupart avait mieux à faire, ce qu’elle comprenait, ou n’étaient pas en état, ce qu’elle comprenait aussi.

Rachel l’avait perçu. Elle n’y avait pas tellement fait attention mais elle l’avait perçu. C’était à lui de décider ce qu’il ferait, de venir s’il s’y sentait prêt, comme toujours. Lui qui se voulait son élève et à qui elle n’avait rien enseigné durant les plusieurs mois écoulés depuis qu’il l’avait convenu parce qu’il n’était pas prêt. Il lui manquait quelque chose, quelque chose qu’elle n’avait pas exigé et elle ne le regrettait pas ; le temps, donner le temps, comme toujours, à nouveau. Ce temps n’était pas encore venu, elle le comprit car lorsqu’il rompit sa position observatrice d’oiseau de proie ce fut pour s’en retourner.

A nouveau, le visage de l’Echo changea, il se ferma dans une résolution triste et sans réellement regarder elle déposa le plateau sur la table, se détournant tant de cette dernière que du groupe en lui-même. Appelant son chapeau de la main, elle l’attira à elle et le prit doucement, marchant vers la sortie du gymnase ; c’était un risque, auquel elle n’avait pas pensé avant mais qu’elle comprenait parfaitement. Décevoir, échouer. C’était toujours ainsi, de toute façon, qui ne tentait rien n’avait rien. Elle avait tenté, pour certain il n’était pas encore trop tard ce soir mais pour l’heure elle préférait s’isoler et penser.

John la regarda partir en serrant les lèvres avant de se retourner vers les deux « grandes » qui étaient toujours autour de lui. Il avait hoché la tête à la négative car il ne s’ennuyait pas et avait regardée la Cornue qui défendait les gens que l’autre attaquait. Il n’avait rien dit, cependant, légèrement absent au débat même s’il avait considéré les autres « non grands » ; ils l’étaient tous, pour lui, que ce soit en taille ou en années. D’autres garçonnets  étaient là, oui, tous plus vieux de trois ou quatre années pour les plus jeunes. Il inspira doucement par le nez puis souffla tout aussi discrètement par la bouche.

Portant sa main libre à son gobelet, il le désigna de l’index à plusieurs reprises, avant de pointer du doigt la sortie du gymnase, regardant tour à tour Ninon puis Kaede en espérant qu’elles comprennent…

- Une boisson… pour Rachel… s’il vous plait.

Sa voix était fluette, n’ayant pas encore muée, mais surtout elle était étrange. Elle avait une sorte d’écho à peine audible, plus discret encore que les paroles qu’il accompagnait et dont la signification était incompréhensible. C’était perturbant, généralement, même si les plus sensibles auditivement pouvaient trouver cela désagréable à l’instar d’un mal de tête. Entre chacune de ses propositions, le garçonnet c’était arrêté, anxieuse, attendant quelques secondes avant de reprendre.

Mais du fait qu’il ne s’était rien passé, il se contenta d’attendre silencieusement qu’on lui donne un gobelet d’il-ne-savait-pas quoi pour simplement s’hocher la tête en remerciement et commencer à s’en aller à son tour, vers la sortie.

L’attention fit sourire celle à qui elle était destinée qui, chapeau sur la tête et bras croisés derrière le bassin, regardait simplement la Lune. L’absence d’un parent et les questions muettes qui ne lui avaient jamais été posées furent balayée par un enfant qui plus que n’être le sien était presque aussi muet. Rachel se retourna vers lui et s’accroupie pour lui prendre le verre, continuant de lui sourire et le remerciant de sa main libre.

_________________
Phénix

"Des monstres ont fait de moi un monstre,
Des divinités ont fait de moi une divinité,
Seuls les humains peuvent faire de moi une humaine."






731 Posts Rp
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Ninon Lenoir
Élève à l'Institut Beta
avatar

Messages : 243
Date d'inscription : 09/07/2014
Age : 24

MessageSujet: Re: Halloween Night {Libre}   Sam 31 Jan - 21:36

_ Je crois que vous avez besoin de soin avant... Euh... Madame l'impératrice.

La Ninon larmoyante attrapa son verre des mains de la ninja avec un petit signe reconnaissant de la tête.

_Merci mon Général, mais j’suis juste qu’une courtisane... Par contre attention hein, ce n’est pas parce que Jade aime mes culottes et qu’elle pense que j’ai la cuisse légère que vous devez essayer de me faire rougir en mettant des choses étranges dans mon verre ! J’ai déjà eu ma dose avec les fraises. Elle prit une gorgée du nouveau breuvage, Oh menthe, c’est chouette la menthe, avant de hausser un sourcil en avisant le rouleau d’essuie-tout que lui tendait toujours Kaede, c’est pour ? Ah, oui, les soins ? On a un blessé sur les bras ?

S’en suivit alors le départ de Nobody pour une chasse à l’alcool et Ninon qui s’était abaissée devant John pour bouder, parce que être grand, ça craignait grave du boudin.

_ Roh mais non, elle dit n'importe quoi. Tss... C'est bien d'être grand Et mes fe.... Tu peux faire plein de chose que tu peux pas faire quand t'es petit Genre manger des fraises et croquer la pomme...?. Mais bon il faut d'abord apprendre à être "grand" parce que ça vient pas comme ça tout seul Nope, ça venait des encore plus grands, donc des vieux, qui passaient leur temps à répéter «  T'es grande maintenant». Faut prendre le temps Et surtout se débrouiller pour attraper un bon gros syndrome de Peter Pan. Moi on m'a obligée à être grande quand j'étais encore petite et c'est pas drôle du tout La dessus, le caractère primaire de la Nini reprit le dessus. Elle aurait volontiers sauté sur son gentil Général pour le/la serrer contre elle et lui offrir un câlin, parce que c'était la seconde personne qui avait trop vite grandi qu'elle rencontrait. La première avait été Jade, sa petite souris au miel qui ne manquerait jamais de démonstrations d'amour peu importe l'heure du jour ou de la nuit. Et puis y a pas que des grands ici en plus.

Ninon balaya la salle du regard à la recherche d'un, ou d'une, camarade de jeu pour le petit John, mais malheureusement, tous les plus jeunes qu'elle réussissait à apercevoir en étaient déjà au stade de la presque-adolescence, alors que le petit lapin terrorisé qu'elle avait devant les yeux ne semblait pas encore avoir vu venir le stade de la pré-adolescence. Bref, tout ça c'était avant que Rachel ne se calme sur les colorants, les conservateurs, l'huile de palme et la viande de cheval reconstituée. (Un esprit sain dans un corps sain ! ...Wait a minute...)

_ Désolée, Ninon releva la tête avec inquiétude, Plait-il ? si je Plus d’inquiétude. De comment ? danse mal, Nini.[Insérer visage paniqué ici] Nononononononon ! Juste que le sang… ça m’a stressée.

Le sang ? son visage se déconfit en même temps que celui de Rachel qui commença à repartir vers l’extérieur du gymnase, non sans avoir récupéré son impressionnant chapeau. Comment ça le sang ? Quel sang ? L’image de la jolie rousse dansant au ralenti devant elle lui revint à l’esprit.

_ Jésus Marie Joseph ! LE SANG ! Elle se releva d’un bond et attrapa le sopalin que lui avait tendu Kaede un peu plus tôt, merci mon Général, de vous soucier de ma santé et de celle de Rachel. Vous serez remercié comme il se doit après une bonne nuit de sommeil, par de généreux avantages en nature. Vous prenez les cookies ? Elle arracha une feuille du rouleau avant de la déchirer pour enrouler deux petits bouchons qu’elle enfonça dans ses narines et soupira. Charisme Nini… charisme…*  

Elle baissa les yeux et rencontra le regard du gentil John qui pointait du doigt les différents verres sur la table.

_ Tu veux quelque chose mon  p'tit la…

_ Une boisson… pour Rachel… s’il vous plaît.

Ninon écarquilla légèrement les yeux, étonnée que John ait finalement retrouvé sa langue mais surtout par le discret écho de sa voix. Toujours stupéfaite, elle hocha doucement la tête et regarda la table  à son tour. Ses yeux passèrent de boisson en boisson, toutes soigneusement triées selon leur taux d’alcoolémie.
En voyant le nombre de bouteilles et de possibilité, elle commença à paniquer et à les regarder une à une sans arriver à se décider sur un parfum en particulier.

_ Une boisson pour Rachel… Une boisson pour Rachel… Une boisson pour Rachel ! Jésus Marie Joseph mais elle voudrait boire quoi Rachel ?! Elle aime quoi ?
Doux Jésus, je ne sais même pas ce que Rachel aime boire...
Heu… bhin…
Ca c’est quoi ? …. Oh, du jus de tomate… non, mauvaise idée.
DES FRAISES ! Rachel aime les fraises ? … Non, elle a déjà la tête qui tourne à cause de mon nez, on ne va pas encore en plus rajouter des fraises, surtout que celles là sont diablement corsées!
Et puis si je donnais des fraises à Rachel, elle penserait que je pense à des arrière-pensées alors que… que… que… que…
BOISSON !
Bonbonbonbonbonbon ! Ninon concentre toi, sinon on n’y arrivera jamais mon trognon !*
Pas de jus de tomates, pas de fraise… Des bulles ? Pas de bulles ? …
Donc un soda…. En même temps, avaler des bulles après avoir avalé un plat de pâte feuilletée n’est pas une bonne idée et les boutons de son gilet risquent de ne pas y résister longtemps….
Et si les boutons déclarent forfait, mon nez aussi et Rachel prendra un aller simple pour le bout du monde sans me donner son adresse pour que je puisse m'excuser !
BON ! Pas de bulles alors… De la grenadine ? … Non, la grenadine c’est une boisson de neuneue à la fraise. Rachel n’est pas une neuneue à la fraise…  
Du jus d’orange ? … Et si c’était trop acide pour son petit estomac délicat et fragile, et que ça la rendait malade ?... En même temps si elle avait un petit estomac fragile et délicat, elle n’aurait pas englouti tant de bêtises surgelées…
De la menthe ? …. Jésus Marie Joseph, si j’offre de la menthe à Rachel elle va croire que c’est un message caché pour lui faire comprendre qu’elle a mauvaise halène ! Je ne peux pas faire ça !

Mon Général ! Pourquoi m’avez-vous donné un verre de menthe ?!

Ninon espèce de paranoïaque, tu divagues, cherche à la place de parler !*
Mais je ne sais pas moi !
… Am… stram… gram… Oh mais non, j’avais dit que la grenadine c’était pour les neuneues ! … D’un autre côté, si ça vient de la part d’une neuneue c’est acceptable, il y a toujours une neuneue dans l’histoire, mais c’est l’expéditrice et non la destinataire…
BON, le destin a choisi et grenadine ça sera !


Elle attrapa un des verres de grenadine sur la table, en vérifiant bien avant qu'elle ne se trompait pas, avant de le tendre à petit Johnny qui avait de nouveau perdu sa langue et qui s'en allait porter sa précieuse cargaison à celle à qui elle était destinée. Ninon le regarda partir en tordant ses doigts nerveusement.

_ Jésus Marie Joseph, j'aurais du lui donner du soda, maintenant elle risque de penser que je pense qu'elle est aussi stupide que moi...
Mon Général ? Je vais avoir besoin de vous, il faudra que vous m'emmeniez loin, très loin... Mais avant, il faut que je m'excuse ! Que je dise à Rachel qu'elle est intelligente, et que quand bien même elle ne le serait pas, bhin moi non plus de toute façon ! Et puis... et puis... et puis...
 Elle termina son verre de menthe d'une traite et attrapa la main de la Ninja. Elle l'attira avec elle pour se faufiler à travers la foule gigottante et adolescente, et ainsi rejoindre l'extérieur. Ninon ne se préoccupa évidemment pas des talons de Kaede, un détail facilement oubliable lorsque l'on était pieds nus. Je dois lui dire que ce n'est pas une question de mal danser ! Mais c'est une question que ça ne se fait pas d'abandonner quelqu'un avec qui on vient de se trémousser pour des surgelés Picard, même si le quelqu'un c'est rien qu'une courtisane neuneue et saignante !
J'ai pas raison mon Général ?
Aie ! Non mais fais attention espèce de malotru, tu as failli me marcher dessus ! C'est parce que je suis si petite qu'on me voit pas ? Que je suis si stupide que je rase les pâquerettes ! Ttss, à défaut d'être joli, tu pourrais au moins être poli !
Bon, allez mon Général, dépêchons, je n'aime pas la foule et la populace.
Il faudra que je lui dire que ce n'est pas ma faute mes problèmes de pression sanguine, c'est à cause de … à cause de... à cause de...
Et puis non à la fin, elle danse bien !
Hey, attention, regarde un peu où tu twerk !
En fait, si, on va pas se mentir, elle danse terriblement mal, mais c'est pas grave, c'est pas important, parce que l'important c'est de danser ! Après bien, mal, c'est subjectif, un coup de cul, c'est comme un coup de crayon, chacun a sa patte !
Mrg... Arrêtez de me rentrer dedans ! Mon Général ! A l'aide !


*En Français
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Kaede Kobayashi
Élève à l'Institut Gamma
avatar

Messages : 288
Date d'inscription : 04/03/2013
Age : 27

MessageSujet: Re: Halloween Night {Libre}   Sam 7 Fév - 13:34

Ah bah enfin, l'impératrice se rendait compte de son écoulement sanglant.
C'était pourtant assez visible. Je ne comprenait pas trop et mettais cela sur le compte des fraises.

Je me sentais mal à la fois pour Ninon qui devait être dans un sacrée embarras et pour Rachel qui devait être elle aussi assez perturbée. Mince ! Moi qui me disait que la soirée restait un bon moment, j'avais l'impression qu'une légère dégradation pointait le bout de son nez. J'avais envie que tout le monde soit plus joyeux que ça, en particulier Rachel qui avait mis tous ses efforts d'organisation dans cette fête. Il fallait donc qu'elle soit la première a pouvoir en profiter. M'enfin, il y avait pour le moment quelque chose de plus urgent.

- Vous serez remercié comme il se doit après une bonne nuit de sommeil, par de généreux avantages en nature. Vous prenez les cookies ?

Cette proposition des plus étrange à mes yeux sonnait à la fois d'une façon malsaine et d'une façon délicieuse. Des avantages en nature ? Je sais que je suis déjà plutôt avantagée naturellement mais ou se trouve le rapport avec les cookies ?

Je me décidais donc de simplement répondre oui. Après tout, des cookies ça me tuerais pas et c'était bon. Je mettais l'incohérence entre les avantages en nature et les cookies dans la boites pleines de mes multiples incompréhension du monde qui m'entoure.

Electro-music:
 
Et tandis que la musique électro reprenait de plus belle, j'eu toute la peine du monde à entendre la petite voix qui s’élevait du garçon. En effet, celui-ci s'était mis à parler, et si je n'avais pas vu Ninon se pencher pour lui répondre, je ne l'aurais surement même pas remarqué.

Par ailleurs, bien que dans l'ensemble la voix du garçon restait tout à fait normal, j'avais l'impression d'une sorte de résonance ou d’écho. Je mettais ça sur le compte de la forte musique qui nous délivrait ses basses dans tout le gymnase.

Vraisemblablement, le petit cherchait à offrir quelque chose à boire à Rachel. Je voyais alors Ninon se mettre dans tout ses états pour trouver quelque chose à boire pour la grande rousse.

Déjà, pas un truc de couleur rouge. Le sang de Ninon avait déjà fait trop de dégâts, alors on va éviter les fraises, les grenadines et autre jus de tomate. Un bon jus d'orange c'était bien ça. Plein de vitamine C qui te requinque rapidement pour retrouver de l’énergie et se remettre à danser !

- Mon Général ! Pourquoi m’avez-vous donné un verre de menthe ?!

- C'est le premier truc qui m'est venue sous la main.

C'était vrais en plus et tout le monde aime la menthe. Enfin presque. J'avais pas chercher à caché une quelconque haleine. Moi je pue pas de la bouche et pourtant j'aime bien la menthe. Bon c'est vrais que ça aide pour les mal odorant de la glotte. Mais la n'était pas le sujet.

En effet, Ninon semblait avoir jeté son dévolue sur de la grenadine. Bon, dilué dans de l'eau, ce n'était pas trop rouge et ne faisait pas penser à du sang. C'était finalement acceptable.

- Jésus Marie Joseph, j'aurais du lui donner du soda, maintenant elle risque de penser que je pense qu'elle est aussi stupide que moi...

Hein ? Mais non, tu dit n'importe quoi, elle va juste le b... Hey !

Wow, c'est la musique qui lui donnait cette énergie ou j'étais devenu si faible que ça ? En un rien de temps, elle m'avait attraper la main et me tirait dans la foule dansante. Alors que l'on aurait pus simplement faire le tour en passant par les fameuses chaises faites pour les gens trop timides, Ninon avait préféré charger dans le milieu grouillant et dansant de la piste de danse. D'accord, c'était le chemin le plus court, mais pas forcement le plus rapide. Et la encore, la musique n'aidait pas puisqu'elle déchaînait ses convives dans des rythmes rapides et une mélodie entraînante.

Du coup, on se retrouvait au milieu d'une foule dansante à nous faire bousculer un peu partout puisqu'on essayait de passer au travers. En plus je n'entendais que la moitié de ce que disais Ninon.


Je dois lui dire ...  une question de mal danser ! Mais c'est une question ça ne se fait pas  ... on vient de se trémousser pour des surgelés Picard, ... rien qu'une courtisane neuneue et saignante !
J'ai pas raison mon Général ?


Eeeeuh oui bien sur !

Aie ! Non mais fais attention espèce de malotru, tu as failli ...  dessus ! C'est parce que je suis si petite qu'on me voit ... ? Que je suis ... rase les pâquerettes ! Ttss, à défaut ... pourrais au moins être poli !

*Continuez de danser, continuez de danser, faites pas attention à elle* pensais-je bien fort.

- Bon, allez mon ... dépêchons, je n'aime pas la ... et la populace.

- Oui la musique est forte sortons.

Il faudra que je lui dise que ce ... est ma faute mes problèmes de pression ... , c'est à cause de … .... ...

Et puis non à la fin, elle danse bien !


- J'en doute pas Ninon.

Hey, attention, regarde un peu où tu twerk !

En fait, si, on va... mentir, elle danse terriblement ... , mais c'est ... grave, c'est pas important, parce que l'important c'est de ... ... subjectif, un coup de cul, c'est comme un coup de crayon, chacun a sa patte !


-Oui. Je vois. D'accord. Aller. On avance. J'étais en mode réponse automatique, je comprenais pas ce qu'elle me disait de toute façon.

-Mrg... Arrêtez de me rentrer dedans ! Mon Général ! A l'aide !

On arrivait enfin dans un coin un peu moins dense, proche de la sortie. Je tirais Ninon autant qu'elle me tirait pour que l'on se sorte mutuellement dans la foule non sans difficultés.

J'ouvrais alors la porte du gymnase, comme sortis d'un champ de bataille et retrouvais un peu d'air frais.

- Et beh j'ai cru qu'on s'en sortirais jamais. Oh regarde ils sont la. Ils ne nous ont pas encore vu.... Ni même entendu. D'ici les basses était encore perceptible bien que la musique était bien étouffée. La fête battait son plein. Il était probable que Rachel savait qu'on était déjà la. Mais le petit John non puisqu'il nous tournait le dos.

Je décidais alors de rentrer dans mon rôle. J'allais avoir une approche de ninja !

- On se rapproche d'eux doucement et on les surprend. En super ninja et euh... impératrice des ombres. D'accord ?

Voila qui lui collait bien au déguisement. On s'approchait alors doucement, les bruits de nos pas couvert par les basses qui s'échappaient des murs et des fenêtre du gymnase.

Et juste à portée de John, je remontais les mains prêts de mon visage en imitant des griffes avec mes doigts et je lançais un simple -Bouh !

Bien que cette idée n'est peut être pas la plus effrayante j’espérais qu'elle est eut l'effet escomptée, à savoir détendre un peu l'atmosphère, surtout du coté de Ninon en faites. Et puis c'est Halloween ! Et Halloween sans une petite frayeur, ce n'est plus Halloween.

_________________
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Echo
X-Men Oméga
avatar

Messages : 1011
Date d'inscription : 10/05/2012
Age : 23

MessageSujet: Re: Halloween Night {Libre}   Sam 7 Fév - 23:30

Grenadine, Rachel aimait cela. Sans être trop sirop puisque son affection allait plus aux sodas, elle l’appréciait tout de même. Doux, sucré, rouge certes mais ce n’était pas l’iconographie du sang qui déclenchait son conditionnement, uniquement sa perception visuelle ou olfactive ; sans quoi elle n’aurait pu regarder la plupart des films et un certain nombre de jeux, voir simplement supporter la perception des flux vitaux des gens l’entourant. Elle savait de qui venait l’initiative et avait perçue la difficulté à choisir des deux autres jeunes femmes, étant reconnaissante aux trois personnes de leur implication dans cela. L’Echo ne pouvait entendre les dires mais ce qu’elle entendait bien fut la musique qui s’échappait du gymnase ; elle ne connaissait pas cette chanson et du fait savait qu’elle ne pouvait provenir de sa playlist à volonté de provenir d’un grand nombre de pays mais que certains aient suggérées de nouvelles musiques au DJ était positif, cela prouvait de l’investissement.

DJ Sona Kinetic (The Crystal Method x Dada Life) by League of Legends on Grooveshark

Musique qui convenait parfaitement à l’odyssée de Ninon et de Kaede à travers les flots dansants, visiblement dans l’idée de les rejoindre à leur tour. Rachel observait cela tout en échangeant un regard avec John, qui était allé jusqu’à ouvrir la bouche pour elle ; cela lui faisait plaisir, même si ça avait été un risque. Le petit était attentionné et loyal, même s’ils ne c’étaient pas rencontrés dans les meilleures conditions. Se souvenait-il de comment elle avait brisés et exécutés les assaillants ? Se souvenait-il de ce qu’elle avait dit à Kaya le concernant ? L’Echo ne pensait pas car si cela avait été le cas, s’il avait véritablement vu le Warhound, il aurait sans doute eu aussi peur que les autres. Il fallait soit être inconscient soit compromiser avec ses valeurs morales pour accepter cet aspect de Rachel, même si généralement on le reprochait au Phénix. Le Phénix avait peut-être pu faire beaucoup de morts par le passé, sur ce monde comme dans d’autres univers, mais il n’avait jamais brulé de rage ou consumé de haine ; le Warhound fonctionnait à cela. La jeune femme était une tueuse en série, c’était un fait qu’elle n’ignorait pas tout autant qu’elle connaissait son mode opératoire et son type de victime : les menaces directes aux vies de ses proches ou à la sienne, voici ce qui déclenchait les pulsions de mort, et la traque puis l’exécution brutale et sanglante, voici ce qui assouvissait ces mêmes pulsions. Un suivi psychologique ou un traitement psychiatrique auraient peut-être put lui permettre de ce débarrasser de cela comme de ses autres troubles mentaux mais seules l’hyperexcitation somatique et la dépression avaient guéris, sans doute que les syndromes de répétition et de l’évitement lui colleraient à la peau à vie, avec ou sans ; et dans le doute, elle préférait faire sans. Elle était composée d’extrêmes et briser cet équilibre lui aurait demandé d’en trouver un nouveau, sans qu’elle put savoir les douleurs et les difficultés que cela impliquait. Rachel ne cherchait pas la normalité, elle n’en voulait pas même, quant à la rédemption elle s’en contrefoutait à présent : seul comptait l’équilibre. Faire autant de bien que de mal, voilà ce qu’elle cherchait, voilà ce qu’elle était. Imparfaite, commandée par la passion et l’émotion, cela lui allait car c’était son naturel, sa nature, même si elle avait été transfigurée par ce qui lui était arrivé. Il ne servait à rien de se demander ce qu’elle serait devenue si tout cela ne lui était pas arrivé : tout cela lui était arrivé. A elle de faire que cela n’arrive pas à d’autres.

Doucement, l’Echo sourit à John. Puis elle porta son verre à ses lèvres et but.

Ninon et Kaede avait fini par sortir du gymnase, se dirigeant vers eux deux et si Rachel se tenait de biais et les avait effectivement perçu venir dans son esprit, John continuait de tourner le dos au bâtiment et à celles qui en arrivaient. L’Echo nota la différence de démarche chez la Cornue sans la comprendre ; elle tentait de se faire discrète, soit, mais pour quoi ? Inutile de chercher, elle le verrait très bientôt. C’était ainsi qu’elle gérait la plupart des problèmes, concevant le temps dans sa simultanéité plus que son décalage, mais ce fut une erreur qu’elle comprit trop tard lorsque son ancienne protégée se plaça derrière le plus jeune pour lui faire peur. C’était basique, certes, mais efficace et son bouh fit sursauter l’enfant qui se retourna. Le cri fut bref mais n’avait assurément rien d’humain, l’écho qui avait accompagnée la voix de John la surpassant clairement au point de l’occulter complètement sur une courte distance ; distance dans laquelle se trouvaient le petit groupe.

Le son ne vrillait pas les tympans mais le cerveau lui-même et apposer ses mains à ses oreilles, premier réflexe qu’eut Rachel alors même qu’elle tombait à genou et broyait son verre, ne servait à rien pour s’en protéger ou même diminuer l’atteinte ; le premier instant c’était la douleur mais lorsque le cri disparu le monde virait au gris puis les victimes perdaient consciences, leurs esprits arrachés de leurs corps. Mais Rachel n’était pas comme eux, elle était le Phénix ou l’Echo du Phénix qu’importait dans une telle situation, et alors que les esprits de Ninon et de Kaede quittaient leurs enveloppes le sien y resta cramponné tel un rocher à travers la tempête, se durcissant de même que son corps se crispait pour résister à l’attaque psychique. Attaque qui se calma rapidement, comme la dernière fois, laissant les esprits déliés s’ancrer à nouveau dans la chair la plus proche d’une façon complètement aléatoire. Mais de l’aléa il n’y en avait guère, puisque John était immunisé à ses pouvoirs et que la télépathe avait dressés ses boucliers psychiques.

Jetant brutalement son résidu de gobelet à l’encontre du sol, Rachel tourna ses regards vers l’enfant responsable, auréolée qu’elle était des flammes du Phénix et de son aura aviaire. Sa respiration était crispée alors même qu’elle tachait de reprendre son calme, contemplant John commencer à paniquer. Fermant les yeux, l’Echo inspira profondément alors que les premiers sanglots parvenaient à ses oreilles. Elle réagit dans l’instant lorsque l’enfant entreprit de s’enfuir, s’élançant par télékinésie à son encontre et lui saisissant d’une main la nuque alors que son autre allait se plaquer contre sa bouche. Oh, le réflexe l’ayant conduit à faire cela n’était pas pour faire taire sa proie mais pouvoir lui briser la nuque cependant la jeune femme n’en fit rien et se contenta d’immobiliser le garçonnet, un genou à terre. Après un instant d’hésitation, elle lui lâcha la nuque pour l’enserrer contre elle.

- Shut, souffla-t-elle contre son oreille, aussi maternelle que possible alors même que de son esprit elle appelait Nobody au secours, l’avertissant de la situation. Ça va aller John. Inspire… Expire… Inspire…

Il pleurait entre ses mains et se débâtait faiblement mais il ne pouvait pas grand-chose contre elle, pas plus cette fois que la précédente. Il n’avait pas perdu conscience ni n’avait du souffrir pour employer ses pouvoirs néanmoins il était en complète panique de l’avoir fait, ne tardant pas à se tétaniser alors que seul son souffle erratique continuait à manifester son affolement. Fermant les yeux, Rachel entreprit de le bercer doucement. C’était le risque à l’avoir emmené quelque part et si elle comprenait parfaitement qu’il faille tenter ce genre de chose pour qu’il ne s’isole pas complètement, l’Echo était forcée de constater qu’ils avaient merdé ce soir. Après, cela aurait put être pire. Même si cela n’aurait jamais été aussi terrible que la dernière fois.

Alors que le Kitsune émergeait comme un fantôme du plan astral, il vint se placer face au jeune garçon et la voix de Nobody ne tarda pas à s’ajouter à celle de Rachel pour le rassurer. Neassa était la seule télépathe à n’avoir parfaitement rien à craindre du pouvoir de John puisque même s’il expédiait son esprit dans un autre corps, sa condition de psyché désincarnée lui permettrait de s’en séparer à volonté. Du fait, elle était la seule à osée la transmission de pensée même quant les pouvoirs de John se manifestaient.

Calmer l’enfant prit plusieurs minutes mais que les deux victimes de son pouvoir reviennent à elles-mêmes en prendrait tout autant, néanmoins Rachel ne voulait pas que John soit là lorsqu’elles se réveilleraient : contrairement à ce qu’on pouvait penser, il resterait le plus traumatisé de l’histoire et s’en voudrait encore longtemps. Qu’il ne s’affole pas à nouveau à cause de l’affolement des deux autres était le minimum pour éviter un renouveau du bordel. Du fait, le garçonnet et le Kitsune entreprirent de marcher côte à côte, pour prendre l’air, alors que l’Echo du Phénix s’en retournait auprès des corps non loin.

D’un geste négligent de la main, Rachel se dépoussiéra par télékinésie du liquide collant contre son oreille, son visage, sa chevelure et sa tenue, puis elle marcha jusqu’aux deux inconscientes. Arrivée à leur niveau, elle s’agenouilla péniblement, ôtant son chapeau en attendant qu’elles se réveillent. Percevoir tant les corps que les esprits lui permettait de n’avoir de doute sur qui était qui et elle prit sur elle de les calmer elles-aussi quant elles s’en reviendraient « à elles ». Une main devant chaque pour les empêcher de se relever et elle pourrait prendre la parole.

- Restez allongées et calmes, s’il vous plait, commença-t-elle doucement, regardant tour à tour les eux autres jeunes femmes, toujours auréolée des flammes du Phénix. Les choses vont vous sembler bizarre, c’est normal : elles le sont. Prenez quelques instants pour vous habituez mais ne paniquez pas. Inspirez… Expirez… Inspirez… Expirez…

Oui, c’était sa technique pour calmer les autres, elle pouvait également aller chercher un souvenir dans leurs esprits pour les aider mais s’en était pas nécessaire pour l’instant. Rachel attendrait qu’elles soient calmées, quitte à devoir les bloquer au sol par télékinésie, avant de cesser son refrain pour entreprendre des explications.

_________________
Phénix

"Des monstres ont fait de moi un monstre,
Des divinités ont fait de moi une divinité,
Seuls les humains peuvent faire de moi une humaine."






731 Posts Rp
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Ninon Lenoir
Élève à l'Institut Beta
avatar

Messages : 243
Date d'inscription : 09/07/2014
Age : 24

MessageSujet: Re: Halloween Night {Libre}   Dim 15 Fév - 23:21

_ On se rapproche d'eux doucement et on les surprend. En super ninja et euh... impératrice des ombres. D'accord ?

Ninon, qui en était encore au stade de s'éventer avec ses mains en soupirant de soulagement après cette épopée en pleine mer humaine, dansante et transpirante, releva la tête avec intérêt.
«  Impératrice des Ombres  », ses joues rosirent de plaisir alors que ses yeux se mirent à briller. Ca, c'était un nom qui en jetait. A la fois élégante et terrifiante, c'était une appellation digne d'un grand cru vintage qui en ferait claquer des dents à plus d'un !
Elle aimait Nini aussi évidemment ! Après tout, c'était Rachel qui avait commencé à lui donner ce petit surnom, et elle ne saurait refuser un geste aussi effectif de la part de sa jolie rousse. Mais Nini... Nini, ça prêtait à sourire et à rire. Nini, c'était le reflet de Ninon, c'était gentil, voir gentillet, mignon, voir mignonnet. Pas méchant, juste adorable, parce que c'était comme ça. Ninon, elle était un peu mimi, un peu neuneue, un peu concon, un peu cucul, un peu nunuche, un peu Nini quoi !
Mais Impératrice des Ombres !
Impératrice des Ombres c'était un sobriquet qui appelait l'aventure et le romantisme (et par romantisme entendez le courant artisco-littéraire du 19ème, pas les romans de Jane Austen).
Impératrice des Ombres, c'était un nom digne d'une héroïne masquée, aussi sombre que mystérieuse, et qui n'agissait que sous le manteau de la nuit !
Les yeux de Ninon papillonnèrent alors que les battements de son cœur s’accélérèrent, et elle ne put que soupirer avec béatitude.

_ Oh oui mon Général...

La française suivit donc la japonaise en sautillant sur la pointe de ses petits pieds nus pour se faire la plus discrète possible, malgré le froufrou continuel du frottement des différentes étoffes de ses jupons. Heureusement pour les deux jeunes femmes, ce détail ne mit pas à mal la réussite de leur opération furtive car camouflé par les basses de la musique qui s'échappaient du gymnase, pour former un bruit de fond assez opaque pour dissimuler leur opération.
Doucement, elles avançaient dans l'ombre vers un gentil petit lapin.
… Si Ninon avait été sobre à ce moment précis, elle aurait de suite compris que ce genre de commando était une très mauvaise idée. Premièrement parce que le petit lapin semblait assez traumatisé comme ça, et secondement, parce que Rachel avait sorti sa tête de « Heing ? »... Or, un traumatisé, une « Heing » et deux neuneus dont une alcoolisée n'était peut être pas un combo à utiliser à tout moment...
Mais comme Nini en avait un petit coup dans le nez (il fallait dire que les fraises avaient une sacrée droite), elle se contenta de suivre son Général, et elle l'imita même en portant ses griffounettes à hauteur de son visage avant de passer à l'attaque !

_ Bouh !

_ Kawabu...

Ninon n'eut même pas le temps de terminer son cri de guerre, ni même de comprendre qu'elle et Kaede avaient fait mouche, qu'elle eut l'impression d'être arrachée de force à son propre corps par un écho assourdissant. Elle gémit de douleur en portant vivement ses mains à ses tempes, juste avant de s’effondrer au sol, inconsciente.

_________

_ … ongées et ca...

_ Mmf... Rachel... la lumièreuh...

A moitié ensommeillée et embrumée, Ninon ne réussit qu'à grommeler vaguement à l'encontre de la rousse qui scintillait de mille feus, ainsi nimbée de son aura de Phénix. Chose qu'elle aurait pu trouver merveilleusement sublime si elle n'avait pas eu cette étrange sensation de gueule de bois forcée et surtout, prématurée.
 
_ ...ont vous sembler bizarre, c’est normal : elles le sont.

Ninon grogna en reprenant doucement pied et elle passa ses mains sur son visage pour tenter de se réveiller.

_ Mrg... Qu'est ce que tu raconte ?... Mgn... Rachel, j'ai tellement mal aux cheveux...

Elle continua de frotter son visage en grognant, mais en remontant ses mouvements, ses doigts rencontrèrent une chose à laquelle elle ne s'attendait pas et elle ouvrit difficilement les yeux en fronçant les sourcils.

_ Prenez quelques instants pour vous habituer mais ne paniquez pas. Inspirez… Expirez… Inspirez… Expirez…

_ Plait-il?

Ninon examina du bout des doigts les deux excroissances qui émergeant de ses cheveux... Cheveux raides et épais... Comment ça cheveux raides et épais ?! Elle écarquilla les yeux.

_ Jésus Marie Joseph, Rachel, il y a quelque chose qui ne va pas ! J'ai des trucs sur la tête et mes cheveux ne sont pas normaux !? Qui a osé me les lisser pendant que je dormais !? Toujours, allongée elle tourna la tête pour tomber sur... Et pourquoi je suis allongée à côté d'une blonde ?! Je n'aime pas les blondes, alors pourquoi j'irais faire la sieste avec une blonde ?
Oh mon dieu, Rachel, me dit pas que j'ai mangé assez de fraises pour faire... pour faire... pour faire...
Oh Jésus Marie Joseph, ma vertu !
En plus une blonde que je ne connais pas et qui s'habille comme une courtis...
Elle s'arrêta dans sa phrase, frappée par l'évidence mais essayant de se convaincre du contraire. Rachel... C'est qui la blonde ? … On dirait... On dirait...

C'est moi.


Elle n'arriva à murmurer cette dernière affirmation que d'une minuscule voix blanche alors que ses yeux terrifiés parcouraient son corps. La panique commença à l'étreindre petit à petit.

_ C'est mon corps... Oh mon dieu c'est mon corps ! Mais qu'est ce qui s'est passé ! Et pourquoi je n'arrive pas à me lever ? Rachel, arrête, c'est pas marrant ! Qu'est ce qui s'est passé ? Pourquoi je vois mon corps, ça veut dire que je ne suis plus dedans ?! Mais si je ne suis plus dedans, je suis où ?  Elle tâta le corps de Kaede, dans lequel elle se trouvait, Je suis dans quelque chose de, je suis dans quoi ? Dans qui ? C'est mou, c'est qu... Ah, mais qu'est ce que c'est que ça !?

Force était de constater que Ninon venait de se rendre compte que la petite paire de cornes n'était pas la seule paire dont elle venait d'hériter... Holy Fuc*ing Jesus!
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Kaede Kobayashi
Élève à l'Institut Gamma
avatar

Messages : 288
Date d'inscription : 04/03/2013
Age : 27

MessageSujet: Re: Halloween Night {Libre}   Mer 18 Fév - 0:19

Les basses me semblaient soudainement si lointaines. La mélodie était totalement étouffé et même ma propre respiration n'était plus perceptible.

Il n' y avait que cette voix, qui entrait en résonance dans ma tête. Cette résonance semblait ne pas pouvoir s’arrêter et je ne pouvais rien y faire. Ma tête vibrait de l'intérieur avec une force effroyable. Cette force de résonance était impossible à combattre et je sentait qu'elle était en train de m’éjecter. Je me sentait partir et tendis qu'un voile noire enveloppait mes yeux, la dernières images que je vit c'était... Moi ?

_____ Blackout  _____

Mon réveille se fit beaucoup plus calmement. Déjà, j'avais de terribles acouphènes. C'était assourdissant. Je me sentais ensuite complètement engourdie et incapable de bouger, voire et entendre. J'étais consciente mais je n'avais aucune réponse de mon corps. J'eu l'impression que des heures étaient passées. Les acouphènes ont alors commencé à se dissiper. Je retrouvais un semblant d'ouïe et je reconnus les basses de la musique qui émanait du gymnase. En faites, je n'entendais pour l'instant que des basses, comme si mon ouïe se reconstituais progressivement vers les aigus. Une voix apparaissait dans le spectre des sons qui revenait à moi. je reconnus la voix de Rachel.

- ... ez all ... -  ... us plai ... - ... s chose ... ont vous sem ... bizarre, c’est normal : elles le sont.

Elle me parle je crois. Ah ça y est. Les engourdissements commençaient à se dissiper. La aussi, cela revenait lentement. J'avais l'impression que mes sens se resynchronisaient lentement. Je n'avais cependant aucune réponse de mon corps aux ordres d'ouvrir les yeux et de tenter de donner un signe de vie ou de communication au monde extérieur.

Et la encore cela revenait avec ce qui me paraissait une lenteur affreuse. Ce fut mes doigts qui répondirent en premier, puis les bras, les jambes, les pieds, la tête et enfin...les paupières.

J'ouvrait les yeux. J’essayais de bouger un peu plus. Mes forces s'accumulèrent dans un bras pour me permettre de me pousser et commencer a me redresser la encore très lentement.
Mais impossible. Rien à faire. J'abandonnais donc pour le moment l'envie de m’asseoir. En revanche, je me redressais un peu, relevant la tête.

C'est à ce moment précis que je remarquais qu'il y avait quelque chose d'absolument pas normal.

- Prenez quelques instants pour vous habituer mais ne paniquez pas. Inspirez… Expirez… Inspirez… Expirez…

En effet, je devais m'habituer. Je sentais que nombre de chose manquait, à commencer par l'absence de la petite douleur de la bretelle du soutient gorge de mon cosplay. Cette douleur absente entraîna l'apparition d'un autre vide. Il manquait une certaine masse que j'avais l'habitude de porter. Je me sentais en faites plus légère. Instinctivement, durant mes respiration et expiration, mon regard se posa plus bas sur mon corps.

- Mais qu'est ce que... ?!?

Oh oui il manquait la effectivement deux masses corporelles. Mais plus que la perte de deux parties de ma fierté, je me rendais compte que j'avais changé de vêtement aussi.

- Comment j'ai ... ?!?

Et puis pourquoi NINON répète exactement ce que je voulais dire au même moment ou je parle !

- Ninon arrête de pa... pa... pa... pa...

J'étais en plein bug, maintenant uniquement capable de balbutier des morceaux de mots. Alors que je tournais la tête vers celle que je pensais être Ninon, je remarquais que ce n'était pas elle que je voyais mais moi. Alors si moi je suis la bas, qui suis-je ?

Mon rythme cardiaque s’envolait soudain tandis que je commençais à peine de me rendre ce qu'il se passait.

Je me forcais à expirer et inspirer comme le disais Rachel, mais non, j'avais en face de moi une Kaede Kobayashi. Une moi qui me rappelait trop des souvenirs d'une seconde moi, bien plus maléfique, capable de tuer par simple envie.

Oh non, je n'étais pas guérie ! Le cauchemar reprenait donc ?

Cette idée se dissipa assez rapidement car la encore, il y avait tout un tas de chose qui n'allait pas, à commencer par le fait que je ne savais pas a quoi pensait cette Kaede. Quand on partage un même esprit on pense quand même ensemble. Par ailleurs, ma seconde Kaede ne s'était JAMAIS matérialisée physiquement.

Non, la Kaede en face de moi était quelqu'un d'autre et le "Jésus Marie Joseph, Rachel, il y a quelque chose qui ne va pas !" me mit sur la voix. La moi d'en face était Ninon. Donc moi j'étais...

Je regardais avec plus de précisions mon corps. Une poitrine beaucoup moins proéminente, des cheveux blonds de Ninon, une voix de Ninon, des vêtements de Ninon.

Soit je rêvait que j'étais Ninon, soit j'étais VRAIMENT Ninon.

Le simple fait tout à l'heure de parler avec une voix qui ne m'appartenait pas m'avais dissuadé  de continuer à parler, alors que ma propre voix semblait y aller de bon cœur.

_Rachel... C'est qui la blonde ? … On dirait... On dirait...

_C'est moi.

_ C'est mon corps... Oh mon dieu c'est mon corps ! Mais qu'est ce qui s'est passé ! Et pourquoi je n'arrive pas à me lever ? Rachel, arrête, c'est pas marrant ! Qu'est ce qui s'est passé ? Pourquoi je vois mon corps, ça veut dire que je ne suis plus dedans ?! Mais si je ne suis plus dedans, je suis où ?  Elle tâta le corps de Kaede, dans lequel elle se trouvait, Je suis dans quelque chose de, je suis dans quoi ? Dans qui ? C'est mou, c'est qu... Ah, mais qu'est ce que c'est que ça !?


Bon et bien, je jetais avec une certaine déception le fait que tout ceci n'était qu'un rêve. C'était bien trop réelle pour ça.

- J'ai bien peur que...Irrrgh Ah c'est pas ma voix ça ! En faites tu es dans moi et moi dans toi. On changé nos corps c'est ça ? Comment c'est possible ?!? Hey attention ou tu te tâte la ! Et...

Oh merde ! Je réalisais une chose. Si elle est dans mon corps, elle a aussi toutes les capacités de celui-ci. Pour le mien, cela voulait dire qu'on venait de donner à Ninon la possibilité de découpé n'importe qui par mégarde.

- -Ninon, Rachel, mon sac. Y a les inhibiteur dedans, elle doit les mettre. Ninon, si jamais tu sent quelque chose remonté le long de ton dos, surtout bloque le. Si tu y arrives pas... regardes vers le bas, ou en haut mais quelqu'un. Mon sac, se trouve dans les vestiaires filles, dans mon casier dans le gymnase. Faut lui mettre sur les cornes et appuyer sur le bouton cadenas jusqu'a ce que les lumières soient vertes.

Mon esprit réfléchissait à cent à l'heure. Je pensais sécurité avant tout. Je voulue me lever mais la encore mon esprit n'était pas encore complètement habitué. J'était plus petite, j'avais moins de force mais je me sentais plus légère et... et le monde tournait un peu autour de moi.

J’essayais de parler le moins possible. J'avais un mal fout à m'habituer à ce corps. Les sensations étaient identiques mais pas du tout dans les même proportions. Je ne sentais plus la plaque greffée dans mon dos, si mes cornes sur la tête. Je ne sentais aucune de mes cicatrices. C'était tellement étrange d'être dans un corps qui me semblait en bien meilleur santé. Sans les traumatismes à vie que le mien avait accumulé. Je n'osait imaginer ce qu'aurait ressentie Rachel si elle avait été dans le corps de Ninon.

Je poussais alors un simple soupir en écoutant les explications de Rachel et en attendant l'arrivée des anneaux inhibiteurs psy.

En faites, je ressentais une certaine peur envers mon corps et pour la première fois de ma vie, je ressentais ce que les autres pouvait ressentir en me voyant, ce que des non-mutants pouvaient ressentir quand ils voient un être capable de faire des choses incroyables mais aussi dangereuse. Je le vivais la en direct, cette peur de moi même, a vouloir à tout prix me mettre hors d'états de nuire. Enfin mon corps en tout cas.

_________________
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Echo
X-Men Oméga
avatar

Messages : 1011
Date d'inscription : 10/05/2012
Age : 23

MessageSujet: Re: Halloween Night {Libre}   Mer 18 Fév - 17:34

- Mmf… Rachel… la lumièreuh…

Cela faisait étrange d’entendre la voix de Kaede avec la façon de parler de Ninon mais pour avoir déjà vécu ce genre de choses, Rachel n’était pas réellement perturbée. Elle serait sans doute la moins perturbée des trois lorsque les deux autres auraient pleinement prises conscience de ce qui ce passait. Et ça, les deux expériences précédentes de l’Echo ne lui apporteraient pas réellement de l’aide : elle était arrivée bien après l’échange lors de la mission du Maine, ainsi le trio c’était déjà habitué à son corps temporaire, et la possession d’Amy avait été faite volontairement, n’étant pas réellement comparable non plus puisqu’il n’y avait eu échange. En tout cas, tant qu’elle parvenait à maintenir le calme, cela irait.

Pour l’instant, le calme était plus maintenu par l’apathie que réellement ses paroles, paroles qu’elle poursuivait malgré les interventions de Ninon sans réellement en tenir compte. Le réveil avait l’air désagréable mais ne serait sans doute pas le plus désagréable, elle comprenait parfaitement. Les expériences extracorporelles pouvaient déjà être bizarres pour les télépathes alors pour les autres… mais le principal était qu’il n’y avait pas de danger, du moins tant qu’aucune des deux élèves ne perdaient le contrôle des capacités de l’autre. Après, quitte à ne pas être dans le bon corps, elles ne lui en voudraient surement pas de manipuler leur esprit pour éviter le pire.

- Mais qu'est ce que…

- Plait-il ?

Encore ? Rachel n’en saurait rien de si c’était plaisant, cela dépendait du rapport entretenu avec son corps et dudit corps également. Elle redemanderait tout à l’heure du coup, si elle n’avait pas oublié entre temps. Elle laissait les deux autres prendre leurs marques, Kaede semblant se rendre plus rapidement compte des changements que Ninon, continuant ses encouragements plus simples à dire qu’à faire alors que la musique changeait à nouveau.

I'm Sexy and I know It by LMFAO on Grooveshark

Les deux élèves commencèrent à paniquer, Ninon usant d’une série d’exclamations interrogatives qui ne devaient pas lui faire le plus grand bien si elle avait vraiment mal à la tête mais ce n’était que le début, une série d’indice jusqu’à ce qu’elle se rende compte du pot aux roses, alors que les choses étaient plus structurées et terre à terre pour Kaede qui demanda même à ce que cette voix qui n’était pas sienne arrête de l’être jusqu’à ce qu’elle fasse le lien. L’Echo avait déjà guidé vers le calme et vu au-delà, maintenant elle laissait les deux autres faire le chemin et cela prendrait un temps.

Kaede tâchait de suivre ce qui lui était demandé alors que Ninon en était à être allongée à côté d’une blonde ; elle admettait donc sa blondeur ! Ahah ! Il suffisait de la sortir de son corps pour qu’elle en fasse de même de son déni sur sa blondeur. Quand à avoir mangées assez de fraises pour faire une sieste avec une blonde… Rachel tourna le visage vers la rouge en levant ses sourcils.  JMJ sa vertu ? Qu’est-ce qu’elle devait foutre là-dedans ? Quand à la blonde, d’une ne pas la connaitre ce n’était pas très platonique, puisque Platon avait dit « connais-toi toi-même », et de deux qu’elle s’habille comme une courtis’ c’était entièrement de sa faute. Quand à qui c’était la blonde, la rousse ne fit aucun commentaire…

- On dirait… On dirait…

- Inspirez… Expirez… Inspirez… Expirez… Lentement…

Elles y étaient, enfin ; et ça n’aidait pas du tout à accomplir ce qu’elle-même demandait. Nouvel instant de panique, accompagné de réflexions auxquelles Rachel ne répondait pas, tâchant de se concentrer et de se faire suivre sans grand succès. La scène était comique, malgré sa gravité, néanmoins l’Echo du Phénix put s’empêcher de rire à défaut de le faire de sourire. Ce qui était déjà pas mal puisque la compréhension de Ninon quand à ce qu’elle avait demandé lui arriva en même temps qu’une palpation allègre du 110D de son corps d’accueil.

- Ninon, reprit Rachel en tâchant de ne pas perdre sa concentration face au bug monumental de celle qu’elle interpelait, Inspire et expire lentement. Tout va presque bien.

Oui le presque changeait tout, mais d’un autre côté les choses n’allaient pas tellement mal puisqu’il n’y avait ni blessés ni morts actuellement. Rien de douloureux ou d’irréparable, en sommes.

- J'ai bien peur que… Irrrgh Ah c'est pas ma voix ça ! En faites tu es dans moi et moi dans toi. On changé nos corps c'est ça ? Comment c'est possible ?! Hey attention où tu te tâte là ! Et…

Kaede restait plus enfantine que la norme, elle avait donc un esprit apte à envisager nombres de choses que d’autres savaient impossibles ; cela fit légèrement sourire l’Echo. Néanmoins les choses changèrent rapidement lorsqu’il fut question des inhibiteurs, même si c’était là une preuve de maturité et de responsabilité de la part de l’ex-Cornue qui prêtait à être fière d’elle également. Les champs psioniques de Rachel protégeaient néanmoins l’extérieur pour l’heure, tant qu’ils englobaient Ninon tout du moins.

Fermant ses deux paires d’yeux, Rachel entreprit de se concentrer pour déployer ses sens psychiques plus avant et localiser puis amener à elles le sac suscité, déverrouillant le casier sans la moindre difficulté ; un sac lévitant tout seul dans les couloirs, à l’Institution Charles Xavier c’était notable mais sans plus, il y avait eu tellement pire.

- Je le ramène, bonne réaction Kaede, déclara l’Echo en regardant le corps de Ninon malgré ses yeux clos, je suis fière de toi.

Mettre Kaede avec Laura avait été prendre le risque que Laura ne sache pas la gérer, mais voir Kaede tâcher de se gérer seule d’une façon des plus impromptues était impressionnant également. Que de progrès.

- Oui, vous avez échangés de corps, reprit-elle à nouveau, s’en retournant à ne regarder aucune des deux. Détendez-vous et tout ce passera bien.

Plus facile à dire qu’à faire, toujours. Mais elle ne les lâcherait pas tant qu’elles représenteraient un danger pour les autres ou pour elles-mêmes. Prenant une grande inspiration, elle mena la danse tant que ce fut nécessaire, par l’exemple cette fois.

- Vous venez de découvrir le pouvoir de John. D’où qu’il n’ose pas parler. Maintenant, on arrangera ça lorsqu’il reviendra, d’accord ?

_________________
Phénix

"Des monstres ont fait de moi un monstre,
Des divinités ont fait de moi une divinité,
Seuls les humains peuvent faire de moi une humaine."






731 Posts Rp
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Ninon Lenoir
Élève à l'Institut Beta
avatar

Messages : 243
Date d'inscription : 09/07/2014
Age : 24

MessageSujet: Re: Halloween Night {Libre}   Ven 27 Fév - 0:55

C’était rond et doux, c’était moelleux et chaud. Bref on touchait (et surtout Nini) à un niveau de fluffiness encore jamais attend  et le moins que l’on pouvait dire, c’était que ça attirait la palpation d’une Ninon aussi hébétée que traumatisée par les évènements.
Cependant ne vous fiez pas aux apparentes sensations à l’intérieur des paumes la française, car même si ces deux excroissances semblaient avoir tout le confort désirable pour un individu externe, il était loin d’en être de même pour un individu interne… Ce n’était pas seulement doux et moelleux, c’était aussi incroyablement encombrant et lourd. D’autant plus lourd lorsqu’on n’était pas habitué à avoir une telle masse sur la cage thoracique, car une fois allongé sur le dos, leur poids n’était pas négligeable. A peu de chose près, Ninon aurait presque pu se sentir comme l’une de ces majestueuses baleines qui venaient s’échouer sur la côte pour finir écrasées sous l’effet de  leur propre poids une fois la poussée d’Archimède disparue. Tragique et injuste punition, conséquence d’un dangereux cocktail de naïveté et de curiosité.  
Mais ni Ninon, ni Kaede n’étaient une baleine, quoi que certains eurent déjà eu des doutes sur la secondes avant de lui préférer la comparaison avec une vache laitière. En ce qui concernait la naïveté, Ninon avait largement sa part de cette saleté et pour la curiosité, c’était malheureusement l’apanage de tous les artistes… Apanage que les fraises avaient en plus largement titillé ce soir, et qui quelque part devait être à la base de ce moment proprement surréaliste.
Bref, Ninon était tout bonnement perturbée par cette encombrante situation à laquelle elle n’avait jamais songé, même dans ses rêves les plus fous.

_ J'ai bien peur que...Irrrgh Ah c'est pas ma voix ça ! En fait tu es dans moi et moi dans toi. On a changé nos corps c'est ça ? Comment c'est possible ?!? Hey attention ou tu te tâtes la ! Et...

Tâter ? Mais quoi donc ?

Ho Jésus Marie Joseph de Jésus Marie Joseph de Seigneur Dieu tout puissant !

Ninon prit conscience de sa position et de la situation, qu’elle avait pour le coup fermement en main. Elle rougit brusquement en retirant rapidement ces dernières, comme si elle venait de se brûler. Gênée de s’être ainsi faite prendre la main dans le sac, elle ne réussit qu’à balbutier.

_ Oh ! Oui, pardon ! Je n’avais pas réalisé que c’était mes… enfin TES… Heum… Oui ! Oh Seigneur comme c’est embrassant, je suis confuse !

L’une dans l’autre et l’autre dans l’une ? En effet, c’était bien sa robe noire toute enjuponnée de froufrous et de mousseline translucide qu’elle pouvait voir sur la jeune fille en face d’elle. C’était aussi ses boucles châtains (on y voyait plus clair avec un peu de recul) et ses grands yeux hébétés qu’elle avait devant les siens… Et réciproquement, c’était effectivement la tenue légère de son général qui semblait couvrir un peu trop partiellement sa peau.
Ninon commença a réellement entrevoir la compréhension de la situation avec inquiétude. L’une dans l’autre et l’autre dans l’une. Cela sonnait de manière particulièrement étrange, et aurait pu être très romantique d’ailleurs ! Je suis toi, tu es moi, blah blah blah… Cependant, Ninon était loin de sauter de joie et préféra suivre les conseils de Rachel en inspirant et en expirant doucement pour garder son calme. Après tout, même dans le corps d’une autre, elle n’aurait su désobéir à sa jolie rousse.
Pour la française, le corps était quelque chose d’on ne pouvait plus intime, à vrai dire, peut-être la chose la plus intime lorsque la tête n’avait rien à cacher, ce qui était le cas de celle de Nini. Et non, on ne prêtait pas son corps comme on prêtait une robe !
Inspiration, expiration, il fallait relativiser, RE-LA-TI-VI-SER !
Après tout, l’échange aurait pu plus mal tomber, pour l’une, comme pour l’autre des deux participantes. Quel individu de type mâle n’a jamais rêvé de se voir coincé dans le corps d’une bimbo aux cheveux de feu ! Et inversement ! Même si les courbes de Ninon étaient nettement moins pulpeuses que celles de l’asiatique, elles avaient très probablement leur public, sans compter que Jade lui avait dit qu’elle était jolie (Huhu, qu’elle était mignonne cette petite Souricette ♥) !
Inspiration, expiration, il fallait relativiser, RE-LA-TI-VI-SER !
C’était vrai après tout, elle était coincée dans le corps d’une rousse, cela aurait pu être largement pire ! Elle aurait pu se retrouver coincée dans le corps d’un homme, et inversement, avoir un homme coincé dans le sien ! Jésus Marie Joseph, la situation n’était peut-être pas si mauvaise que cela dans le fond…
Après une dernière respiration profonde, Ninon se redressa doucement pour pouvoir s’asseoir sur l’herbe rendue fraiche par la rosée nocturne, mais à mi chemin, quelque chose coinça. Elle ressentit une raideur inconnue dans le bas de son dos qui mit court à la souplesse de son mouvement et qui lui fit serrer les dents sous la surprise.  Elle passa une main sur ses reins mais ne sentit rien de particulier, la douleur était bien plus profonde qu’un simple tiraillement en surface.
Une fois la mobilité retrouvée, les différences entre ce corps et le sien commençaient à apparaître. Hormis la possession d’un poitrine avantageuse, celui-ci était aussi plus musculeux, et Ninon ressentit une sorte de puissance latente quasi inexistante dans son propre corps. Il y avait aussi de divers tensions ici et là, certainement dues à des cicatrices et des séquelles de traumatismes plus profonds.
Bref, même si ce corps était plus fort, plus résistant et plus puissant, il avait aussi bien plus vécu que le sien malgré le jeune âge de l’asiatique.

_ Ninon, Rachel, mon sac. Y a les inhibiteurs dedans, elle doit les mettre.

L’intéressée vit l’expression de son visage se transformer rapidement, et l’inquiétude avait maintenant pris la place de l’hébètement dans ses traits. La sensation fut contagieuse puisque Ninon fronça imperceptiblement les sourcils, en ne comprenant pas à quoi Kaede faisait référence, même si ce mot lui disait quelque chose. Elle l’avait déjà entendu il n’y avait pas si longtemps que ça. Inhibiteur… inhibiteur… Rha ! Mais il y avait eu des fraises avant ça ! Inhibiteur… Et puis il y en avait aussi eu entre temps !
Oh, ça y était, c’était Rachel qui en avait parlé et qui avait mis la japonaise en garde. Mais contre quoi ?

_ Ninon, si jamais tu sens quelque chose remonter le long de ton dos, surtout bloque le.

L’inquiétude de Ninon grandit un peu plus. Quelque chose ? Mais quelque chose comment ? Et non pour le moment elle ne sentait rien mais… mais … mais … mais c’était comme tout, maintenant qu’elle en avait parler, elle se mit à sentir tout un tas de trucs dans son dos, en commençant par l’arrière de son sous-vêtement trop serré qui s’imprimait dans ses chairs, jusqu’à la caresse fraîche de la nuit. C’était bête et c’était surtout dans la tête, mais c’était exactement pareil que lorsque quelqu’un demandait « Ca gratte ? » et qu’irrémédiablement l’endroit le plus improbable de votre corps commençait à vous gratter. Et d’ailleurs, rien que d’en parler, vous ne devriez pas tarder à ressentir des démangeaisons psychologiques ! Alors non, ce n’était pas la bonne chose à dire parce que Ninon commençait à imaginer tout et n’importe quoi dans son dos.

_ De ? Comment ça ?!

_  Si tu y arrives pas... regardes vers le bas, ou en haut mais pas quelqu'un.

Ninon se regarda en écarquillant les yeux. Ne pas regarder quelqu’un ? Mais pourquoi ? Elle hésita en regardant alternativement le ciel et l’herbe avant de se décider pour les étoiles qu’elle ne vit plus car elle ferma les yeux aussi fort que possible.

_ Mon sac, se trouve dans les vestiaires filles, dans mon casier dans le gymnase. Faut lui mettre sur les cornes et appuyer sur le bouton cadenas jusqu'à ce que les lumières soient vertes.

_ Je le ramène, bonne réaction Kaede, je suis fière de toi.  Oui, vous avez échangés de corps, détendez-vous et tout ce passera bien. Vous venez de découvrir le pouvoir de John. D’où qu’il n’ose pas parler. Maintenant, on arrangera ça lorsqu’il reviendra, d’accord ?

_ Bhin on a pas le choix... Si ?
Mais… mais… mais… mais je fais quoi maintenant ? Je peux ouvrir les yeux ? A quoi ça sert ? C’est pas dangereux au moins ? Parce que ça a l’air dangereux et… et… et… et…


Inspiration… Expiration

_ Pauvre lapin, il doit s’en vouloir, déjà qu’il n’était pas très bavard…
Gnmrf… Je vais attraper un torticolis à rester comme ça moi... Enfin TU vas attraper un torticolis si je reste comme ça !
Et fais attention, je t’ai à l’œil ! Enfin là c’est compliqué, mais je t’aurai à l’œil, pas de bêtises dans mon corps et ne fais rien qui pourrait m’embarrasser ! Enfin pas plus que d’habitude… Heum… Dis comme ça, ça te laisse un champ d’action assez vaste en fait.
Bon, tout ce que je te demande, c’est de ne pas vomir et d’y aller doucement sur ce qui se mange. Han ! Et PAS de viande, je te jure que si tu me fais manger de la viande je … je… je… je te demande juste pas de viande, de toute façon, c’est pas compliqué, si ça a eu une famille avant d’arriver dans ton assiette, tu n’y touche PAS ! Et à plus forte raison si ça a eu des poils. Manges plutôt du chocolat à la place si ça peut te consoler !
Mrgh… Et tu as des problèmes de dos épouvantables, ton soutien gorge est mal ajusté, il ne soutient rien.
Rachel ? Dis ? Comment ça se fait que ça ne t’ai rien fait toi ? Pourquoi c’était juste Kaede et moi ?


Enfin je ne dis pas ça parce que j’aurais préféré me retrouver chez toi ! Enfin j’aurais aimé ! Enfin c’est pas ce que je veux dire, je veux juste dire que ça ne m’aurait pas dérangé mais pas dans le sens où j’aurais voulu en particulier aller chez toi c’est juste que … que … que … Heum … Et je ne veux pas non plus te vexer mon Général, c’est bien aussi chez toi, c’est différent, il y a de la place.


Oh Seigneur ! Je ne veux pas dire par là que tu es grosse, tu es très bien, tu as juste plus de.. plus de… de jolies formes et … et… et je suppose qu’elles peuvent offrir un confort incomparable et… et… et…
Jésus Marie Joseph, tais-toi Nini tu me fatigue à la fin… *


*En français
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Kaede Kobayashi
Élève à l'Institut Gamma
avatar

Messages : 288
Date d'inscription : 04/03/2013
Age : 27

MessageSujet: Re: Halloween Night {Libre}   Jeu 5 Mar - 0:20

- Vous venez de découvrir le pouvoir de John. D’où qu’il n’ose pas parler. Maintenant, on arrangera ça lorsqu’il reviendra, d’accord ?

Oui, ça j'étais d'accord. J'étais même d'accord pour avant, pour après, pour n'importe quand du moment qu'il y avait un moyen d'inverser les effets de son pouvoir. Je comprenais d'ailleurs maintenant mieux pourquoi le petit John parlait pas beaucoup. Ce n’était pas que de la timidité. Son silence était l'équivalent de mes anneaux. Anneaux qui arrivaient d'ailleurs par voix télékinétique express !

Je m'empressais de les sortir du sac et de les lui poser sur les cornes.

- Mais… mais… mais… mais je fais quoi maintenant ? Je peux ouvrir les yeux ? A quoi ça sert ? C’est pas dangereux au moins ? Parce que ça a l’air dangereux et… et… et… et…

-Rooh aller, c'est bon, ça va pas te manger, ça va pas te tuer et ça ne va pas te faire mal.

Une fois posés, j'appuyais délicatement sur le bouton de synchronisation des deux inhibiteurs. Il fallait rester appuyer une minute sur les deux boutons pour qu'ils se synchronisent et se verrouillent sur les cornes.Non pas qu'ils étaient long, mais c'était simplement une sécurité. Et une minute c'est long.

- Pauvre lapin, il doit s’en vouloir, déjà qu’il n’était pas très bavard…

Et je connaissais parfaitement cette situation. Cette sensation de culpabilité qui vous habite pour quelque chose que vous avez fait sans le vouloir. Le petit s'en sortait plutôt bien. Moi j'avais tué 4 enfants dans cette même situation. Pas de chance. Quoiqu'il en soit il faudra le rassurer avant tout. Autant, nous sommes grandes et arrivons a garder notre sang-froid, notamment grâce au professionnalisme de Rachel, autant John était bien plus jeune. Il était donc plus sensible.

-Gnmrf… Je vais attraper un torticolis à rester comme ça moi... Enfin TU vas attraper un torticolis si je reste comme ça !

- Oui bah je préfère attraper un tortitruc que tu te mette a découper des gens à tout vas..., même sans le vouloir.

- Et fais attention, je t’ai à l’œil ! Enfin là c’est compliqué, mais je t’aurai à l’œil, pas de bêtises dans mon corps et ne fais rien qui pourrait m’embarrasser ! Enfin pas plus que d’habitude… Heum… Dis comme ça, ça te laisse un champ d’action assez vaste en fait.
Bon, tout ce que je te demande, c’est de ne pas vomir et d’y aller doucement sur ce qui se mange.


-Ui, ça va, madame l'impératrice, je prendrais soin de votre corps

- Han ! Et PAS de viande, je te jure que si tu me fais manger de la viande je … je… je… je te demande juste pas de viande, de toute façon, c’est pas compliqué, si ça a eu une famille avant d’arriver dans ton assiette, tu n’y touche PAS ! Et à plus forte raison si ça a eu des poils.

- Ouiiiii pas de viande, d'accord. Autre chose peut être ?

Quand je vous disais qu'une minute c'était long, en faites, je pesais mes mots. C'est trèèèèèès long dans certaines situations.

-Manges plutôt du chocolat à la place si ça peut te consoler !

-D'accord, du chocolat, si tu veut.

- Mrgh… Et tu as des problèmes de dos épouvantables.

- C'est la greffe que j'ai dans le dos. J'ai fait un don forcé de quelques vertèbres en échange d'une greffe de contrôle par épine dorsale. Tu la retire, tu me paralyse à vie. Évite d'y toucher, même si c'est solide. Je supporte pas ça moi même, alors si quelqu'un d'autre y touche...

-Ton soutien gorge est mal ajusté, il ne soutient rien.

- C'est le principe du costume loué pour une soirée. C'est pas à ta taille mais tu le portes quand même parce que c'est jolie. Puis tu le rend.

- Rachel ? Dis ? Comment ça se fait que ça ne t’ai rien fait toi ? Pourquoi c’était juste Kaede et moi ?


Enfin je ne dis pas ça parce que j’aurais préféré me retrouver chez toi !


-Hein ?

- Enfin j’aurais aimé ! Enfin c’est pas ce que je veux dire, je veux juste dire que ça ne m’aurait pas dérangé mais pas dans le sens où j’aurais voulu en particulier aller chez toi c’est juste que...

Petit impératrice à Artaxx, petite impératrice à Artaxx, sortez de la immédiatement, vous êtes en train de sombrer !

… que … que … Heum … Et je ne veux pas non plus te vexer mon Général, c’est bien aussi chez toi, c’est différent, il y a de la place.

-Pardon ?

Petite impératrice à Artaxx, il serait bon de vous sortir des sables mouvants vous êtes en train de couler !

- Oh Seigneur ! Je ne veux pas dire par là que tu es grosse, tu es très bien, tu as juste plus de.. plus de… de jolies formes et ...

Et il était temps de la faire taire.
Je ne savais pas si c'était pour copier Rachel, de la soirée de l'année dernière, ou si c'était les restes d'alcool qui pulsait encore dans mon corps, ou simplement l'influence de Laura sur moi, mais je n'avais trouvé, comme moyen de la faire taire, que de poser mes lèvres sur sa bouche, vu que mes mains étaient occupées et que je ne pouvais l'étouffer avec mes seins.

- et je suppose qu’elles peuvent offrir un confort incomparable et… et… et… *Smmmmmmmmmmmack*

-T'ché t'choi un peuch

Au même moment, les inhibiteurs passèrent au verts.

- C'est bon ? Tu es calmée ? No stress ? On expire et on inspire ?

C'est en sentant les quelques regards sur moi que je remarquais alors que ce n'était peut être pas la meilleur des idées que j'ai eu depuis quelques temps. Je me sentis alors assez gênée, par mon propre geste. Bien jouée, général !

- Rachel ? Tu sais ou se trouve John ? Que j'ailles m'excuser au plus vite auprès de lui, c'est ma faute après tout.

Connaissant la douleur que c'est d'infliger aux autres des choses non voulues par soit même, je voulais vraiment lui présenter mes excuse. C'était la moindre des choses. Ce petit était encore si innocent, si fragile, il n'avait pas à subir ce genre de chose.

_________________
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Echo
X-Men Oméga
avatar

Messages : 1011
Date d'inscription : 10/05/2012
Age : 23

MessageSujet: Re: Halloween Night {Libre}   Mar 10 Mar - 20:09

Ninon se retira violemment en déclarant haut et fort sa situation, ou plutôt qu’elle n’avait justement par réalisée sa situation alors que pourtant elle avait les doigts dessus. Quand à la propriété c’était une question de points de vue, selon Rachel. En bonne télépathe privilégiant l’esprit au corps, elle comprenait parfaitement d’user du possessif dans la situation présente et avait même voulu le faire avec Amy, chose faisant qu’elle comprenait aussi qu’on ne veuille pas le faire. En tout cas, Ninon et Kaede désignaient les esprits, non les corps, à ses yeux. Après s’il fallait inverser les désignations, cela ne lui poserait pas de problème non plus ; au pire, elle userait de Ninon-Kaede et de Kaede-Ninon, toujours l’esprit devant mais avec plus de respect pour le corps. Néanmoins pour l’heure, il fallait garder le calme. Et malgré quelques poussées mentales de la française, elles y arrivaient à peut-prêt.

Rachel leur laissa donc plus de libertés de mouvement, accompagnant aussi bien psioniquement que physiquement les deux autres. Et la discussion se fit rapidement entre les deux interchangées, quand bien même elle en était l’instigatrice. Pas le choix que d’attendre John, elle hocha la tête.  Quand à savoir ce que Ninon-Kaede devait faire, ce fut Kaede-Ninon qui lui répondit en connaissance de cause, ayant attrapés les inhibiteurs bien vite arrivés et s’avançant jusqu’à la première pour les lui mettre.

- Pauvre lapin, il doit s’en vouloir, déjà qu’il n’était pas très bavard…

Oui, il allait s’en vouloir, quand à ne pas être très bavard, il y avait relation de causalité ; pourquoi les gens avaient toujours du mal avec cette notion ? Une chose en entraine une autre, c’était simple pourtant, non ? 1+1=2, l’adition d’un avec un faisait deux uns, donc deux. L’Echo du Phénix ne fit aucun commentaire.

Le dialogue ce fit avec les voix inversées, ne tardant pas à perdre Rachel qui prit la bonne décision : attendre que ça passe. Il y avait toujours des problèmes de possessifs mais ça ne s’arrangerait pas à moi d’accord entre les partis, chose commençant à arriver mais pas sur ce sujet-là. Après elles pouvaient bien se donner les consignes qu’elles voulaient, il n’y avait pas grand-chose à faire à part rester là et attendre la solution. Néanmoins là où Rachel tiqua se fut sur le pas de viande, avec un « pas » bien marqué ; une végétarienne ! Ninon était végétarienne. Enfin, végétarienne de ce qui avait eue une famille avant d’arriver dans l’assiette ; les petits pois étaient considérés à l’individualité ? Si oui, ils avaient une famille alors, pourtant c’était pas de la viande. Mais dans tous les cas, le végétarisme c’était une étrangeté que Rachel pouvait accepter à défaut de comprendre. A moins qu’il ne s’agisse de craindre que des poils soient passés au travers de la cuisine et donc qu’il y ait des poils dans l’assiette mais là… Ninon n’avait-elle jamais fait tomber de cheveux dans son assiette ? N’avait-elle jamais eu de cheveux sur la langue ? Certes, c’était de la kératine, mais c’était digéré comme le reste à défaut d’apporter quelques nutriments que ce soit… Et puis il pouvait parfaitement y avoir des cheveux dans le chocolat aussi ! Et dans les soupes !

Continuant de regarder la scène d’un point de vue extérieur, Rachel finit par simplement se relever, ramenant ses champs psioniques à son propre corps. L’explication sur le passif de Kaede comme sur le costume de Ninon-Kaede prévu pour la première fut écoutée mais il n’y avait de commentaire à faire, Rachel n’était pas capable de recréer des vertèbres en l’était actuel des choses même si elle supposait que l’énergie vitale suffirait bien à soigner la Corne même après retrait de son implant, tandis que le costume loué c’était une aberration ; enfin, du point de vu de quelqu’un alternant trois tenues qu’elle transformait les fringues c’était trop personnel pour être loué.

- Rachel ? Dis ? Comment ça se fait que ça ne t’ai rien fait toi ? Pourquoi c’était juste Kaede et moi ?

L’Echo croisa les bras sur son torse et son visage se fit plus pensif car si elle n’avait besoin de réfléchir pour répondre elle le faisait tout de même afin de savoir jusqu’où pouvait-elle le faire. Et Ninon-Kaede ne lui laissait pas réellement le temps de le faire avant de renchainer pour préciser une chose assez vexante. Et revenir dessus juste après ! Kaede-Ninon n’était pas la seule à buguer pour le coup, la plus grande du lot levant les sourcils en continuant de surplomber la scène en lui faisant de la lumière ; potentiellement la seule lumière qu’on y trouvait d’ailleurs, en plus de celles filtrant depuis le gymnase et de celle de la Lune.

Ninon-Kaede continua de faire du… Ninon puissance Kaede, sans doute. Comme quoi le physique avait une influence sur l’esprit. Ou alors Ninon savait bien cacher sa maladresse de nature, à moins qu’elle ne fasse tout simplement pas les choses à moitié. En tout cas, sa confusion ne l’aidait pas et elle continua d’essayer de ne vexer personne en ayant des paroles pouvant le faire. Toujours les bras croisés, Rachel ne fit pas le moindre commentaire ; elle finirait bien par avoir son tour pour parler.

Ou pas, vu la réaction de Kaede qui lui fit écarquiller les yeux… C’était une tradition, hein ? Qu’une bourrée embrasse une sobre le soir d’Halloween, c’était du déjà entendu même si l’Echo ne s’en souvenait pas, sauf que la dernière fois c’était la Cornue qui avait reçu alors que là c’était Kaede-Ninon qui avait donnée à Ninon-Kaede. Bon, et la dernière fois il y avait eu beaucoup plus d’alcool dans le sang pour expliquer excuser ce fait ! Là, à peine si Kaede-Ninon avait héritée des quelques fraises en trop consommées par Ninon… même si lesdites fraises avaient eu l’air de faire un sacré effet. Mais nan, Kaede-Ninon avait l’air parfaitement normale, le détail du corps excepté, les instants précédents.

- C'est bon ? Tu es calmée ? No stress ? On expire et on inspire ?

- Et toi ?

Rachel visait directement Kaede-Ninon, encore sous le coup de la surprise et de la perplexité. Sans chercher à comprendre, ce n’était pas le genre de situation à laquelle elle pouvait s’attendre surtout considérant le micmac qu’était déjà ladite situation. Regardant la « fautive », l’écoutant essayer de changer de sujet, l’Echo poussa un bref soupire.

- T'sais Kaede, c’est pas parce que je t’ai embrassée étant bourrée que tu dois le refaire, hein ?

Commencer par expliciter les choses, toujours, avant de changer de sujet. Néanmoins, Ninon n’aurait pas sa réponse du coup, trop d’événements.

- John se balade avec Nobody pour reprendre son calme. On va tâcher de les attendre ici.

Rachel ne savait pas où exactement en étaient les deux autres psychites, ne les percevant plus avec ses sens psychiques, néanmoins si elle pouvait les retrouver facilement elle préférait leur laisser le temps d’aller à leur rythme, tout en comprenant que ce n’était pas forcément facile pour les deux jeunes femmes non plus. Certes, attendre ici n’était peut-être pas la meilleure idée si d’autres élèves s’en venaient à leur rencontre, mais cela valait sans doute toujours mieux que de brusquer John ; encore que le brusquer pouvait le faire renvoyer tout le monde dans son corps, puisque personne d’autre que Nobody ne pouvait survivre sans. C'était ce qui avait été fait, la dernière fois…

- Ninon, ça va ?

_________________
Phénix

"Des monstres ont fait de moi un monstre,
Des divinités ont fait de moi une divinité,
Seuls les humains peuvent faire de moi une humaine."






731 Posts Rp
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Ninon Lenoir
Élève à l'Institut Beta
avatar

Messages : 243
Date d'inscription : 09/07/2014
Age : 24

MessageSujet: Re: Halloween Night {Libre}   Mer 25 Mar - 22:30

OH P*TAIN DE B*RDEL DE NOM DE DIEU

Non contente de lui titiller les cornes depuis un peu plus d'une quarantaine de secondes, Kaede avait surtout franchi leurs derniers centimètres d'intimité en collant ses lèvres sur les siennes ! Quoi que non, c'était Ninon qui techniquement avait ses lèvres sur celles de Kaede, parce qu'en ce moment même c'était Kaede qui était dans le corps de Ninon et Ninon qui était dans le corps de Kaede, donc Kaede avait littéralement ses lèvres sur les siennes à elle, alors que Ninon avait indubitablement ses propres lèvres collées aux siennes à elle.
Non non non non non !
Illogique, parfaitement illogique !

Jésus Maris Joseph, il fallait tout reprendre depuis le début, qui embrassait qui à la fin? Kaede embrassait Ninon, vu du point de vue de leurs consciences respectives. Mais les corps eux ! Et bien les corps eux, ils avaient la conscience tranquille et c'était belle et bien le corps de Ninon qui avait agrippé celui de Kaede !
Non non non non non !
Illogique, parfaitement illogique, Nini n'aurait jamais fait une chose aussi triviale !

Rendez son corps à cette pauvre petite qui n'aura même pas pu profiter de son premier baiser roux à l'intérieur de son propre corps. A la place c'était la rousse qu'elle était censé embrasser qui en avait profité !
Bien sur, sa conscience avait embrassé la conscience d'une rousse, mais une fois encore, les corps avaient la conscience tranquille et c'était bien son corps, dans lequel elle ne se trouvait pas, qui avait eut droit aux lèvres de la pulpeuse rousse, dans laquelle elle se trouvait.
Et réciproquement, par ce baiser, Nini avait embrassé une châtain clair... Remarquez, la situation aurait pu être bien pire, elle aurait pu embrasser un blonde.
Jésus Marie Joseph !
Pour une fois qu'une rousse voulait bien lui sauter dessus, il fallait qu'elle soit à l'intérieur de cette dernière et que ce soit la rousse qui embrasse la rousse ! Tss, des rousses qui embrassaient des rousses, mais où allait le monde? Des rousses qui … qui …

Une chance qui Ninon ne se soit pas trouvé à l'intérieur de son propre corps, sinon Rachel aurait dévoré le restant des surgelés Picard, leur plat et la main de la pauvre âme qui le lui aurait tendu...
Non non non non non !
Illogique, parfaitement IL-LO-GIQUE !


_C'est bon ?

Si c'était bon ? Dur dur de répondre à cette question tendre Général !
Dire non reviendrait à se tirer un balle dans le pied ! Mais d'un autre côté, dire oui aurait été sacrément narcissique !  
Alors oui, bien sur, Ninon aurait peut-être un peu plus profité du moment dans son propre corps, mais grosso modo, ce n'était pas mauvais. La française avait les lèvres roses et douces, une haleine à la fraise, bref, peu s'en seraient plaint, et certains y auraient même trouvé un goût de reviens-y.


_ Tu es calmée ?

Oh, elle était peut-être légèrement rouge, mais elle était très calme la Ninon ! Les yeux écarquillés sur la Kaede squattant momentanément son corps, elle ne bougeait pas, ne cillait pas, ne frémissait pas et ne respirait même pas...
Nini, mon p'tit trognon, la respiration, c'est pas en option ! … Nini ? … NINI !

_No stress ?

NINI ! C'est le moment de te stresser et de respirer ! Nini, pense à tout ce que tu vas manquer si tu arrêtes de respirer maintenant ! Tout le chocolat que tu n'as pas encore pu goûter, les fraises que tu n'as pas encore pu manger, les valses que tu n'as pas encore pu danser et les rousses que tu n'as pas encore pu embrasser ! Aller Nini, ressaisis toi, la soirée n'est pas fini et les prochaines lèvres qui se déposeront sur les tiennes seront peut-être celles de Rachel !

_ On expire et on inspire ?

Lààààà... Ca allait tout de suite mieux venant d'une rousse. Enfin d'une rousse dans un corps de châtain.
Inspiration, expiration... Inspiration, expiration... Inspiration...

- Ninon, ça va ?

Comment ça celles de Rachel?!... hyperventilation. De ses yeux débridés par la stupeur, et nouvellement rouges, Nini fixait Rachel, alors que sa poitrine se soulevait et s'abaissait à un rythme bien trop rapide.
Il fallait respirer... inspiration... expiration... inspiration...
hy-per-ven-ti-la-tion:
 
En plus, d'après ce qu'elle avait entendu, la rousse avait déjà embrassé la japonaise ! INJUSTICE ! RACISME ! SEXISME ! Capilarisme ? …
Parce qu'il était bien là le problème. Ce n'était pas une question de sexe ou de nationalité, mais bel et bien de cheveux.
Nini était-elle destinée à finir frustrée parce que les rousses ne semblaient aimer que les rousses ?
Inspiration... Expiration...
Même si ce n'était qu'en ronchonnant, la plus mauvaise des mauvaises idées était encore de penser à embrasser une rousse alors que l'on était présentement à l'intérieur de l'une d'entre elle. Et la petite Nini savait très bien que ce genre d'émotion, toujours intense, faisait monter sa pression artérielle au point de lui faire gicler le trop plein par les narines...

_ Jésus Marie Joseph, je crois que je vais saigner du nez !

Elle plaqua ses mains contre cette étrange bombe à retardement qui risquait d'exploser à tout moment, mais les secondes passaient et rien n'arrivait.

_ Je... Je ne saigne pas... pourquoi ? Seigneur, je suis guérie ! Je suis... pas chez moi.
...
Je le savais bien, c'était trop beau... Mais mon Général, ça veut dire que c'est toi qui risque de saigner ! Surtout, si ça arrive, tu ne paniques pas, et si tu paniques, tu m'appelles. Ce n'est pas dangereux, c'est juste un tantinet embarrassant. Mais bon, l'embarras et moi, ça fait longtemps qu'on se connaît et on est même plutôt proches.
Par contre, ça effraie Rachel, et... et...
Elle se tourna vers l'intéressée en souriant, Et on va tacher de ne pas t'effrayer, ça a l'air d'être mauvais pour ta ligne. Enfin pas que ta ligne soit mauvaise et qu'elle risque de l'être, c'est... C'est juste une métaphore Rachel tu es parfaite, enfin je veux dire que tu as une très jolie ligne, enfin jolie de la manière que tu es comme tu es et.. .et..
Jésus Marie Joseph, ça va pas recommencer...*
Bref, ne change rien, tu es très bien et mange tant que tu le veux !
Heu... et si on se levait? Parce que ce n'est pas le tout, mais l'herbe est fraîche et tes fesses, ainsi que les miennes, vont être trempées si on y reste assises. Donc debout !


Après un premier essai, Ninon retomba fatalement sur les fesses de son corps d'accueil... Heureusement que le ridicule ne tuait pas, et puis ce n'était pas sa faute, c'était plutôt celle de son talon qui s'était enfoncé dans la terre en y prenant appuis. Une chance que la japonaise avait choisi un costume avec un short, sinon sa vertu se serait envolée comme une hirondelle au printemps.

_ Aieuh... Mmrf, comme quoi, la taille du coussin importe peu, ça fait toujours aussi mal... Heeuu .. Je … je … je … C'est pas ce que tu penses mon gentil Général ! Je ne parlais pas de tes fesses ! Enfin, pas complètement, je parlais de l'herbe ! Elle n'a pas amorti la chute et... et... et... Et tes fesses non plus, mais les miennes ne l'auraient pas plus fait et... et qu'est ce que je voulais dire ?...
Oh, pardon, je ne voulais pas insinuer que tu étais... Enfin je veux dire que tu es parfaite, à tel point que je suis plutôt heureuse d'être chez toi. Si si, je t'assure que c'est vrai !
Oh pardon mon Général... Vous m'accorderiez une danse pour me faire pardonner ? Je promet même de ne pas te saigner dessus. Et si ça ne suffit pas, je referai des cookies !
Bon, debout debout debout !
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Kaede Kobayashi
Élève à l'Institut Gamma
avatar

Messages : 288
Date d'inscription : 04/03/2013
Age : 27

MessageSujet: Re: Halloween Night {Libre}   Lun 30 Mar - 23:09

- Et toi ?

Je souriais, bêtement, devant ma connerie. J'en étais fière en faites.

- T'sais Kaede, c’est pas parce que je t’ai embrassée étant bourrée que tu dois le refaire, hein ?

C'était comme une sorte de tradition en faites ! Et on sait tous que les japonais sont très attachés a leurs traditions. Au final c'était tout à fait logique. La tradition veut que le jour d'halooween, une rousse vole un baiser d'une autre personne ! C'était comme ça. Alcool ou non. Et puis j'avais même pas mis ma langue ! J'avais juste posé mes lèvres sur sa bouche pour la faire taire. Mission tout à fait louable pour nos pauvres petites oreilles déjà bien abîmées par la musique électronique qui continuait de vrombir dans le gymnase jusque dehors.

-Oui... Mais n'empêche que je l'ai pas fait comme toi avec moi ! Et je pense que ça doit devenir une tradition maintenant ! Comme pour d'autre jours ou on fait des cadeaux aux autres ou que l'on faites le nouvel an, la on va fêter haloween et les bisous surprise !

C'était con comme idée, mais je trouvais ça drôle.

Cependant, ce fut peine perdue. A vouloir faire taire mon propre corps l'effet inverse s'était produit ! Elle parlait encore et encore et encore ! Mon dieu, je me voyais comme quand je le faisais ! Je comprend maintenant pourquoi les autre n'en pouvait plus de mes monologues !

Je... Je ne saigne pas... pourquoi ? Seigneur, je suis guérie ! Je suis... pas chez moi.

Beh non ...
...
- Je le savais bien, c'était trop beau... Mais mon Général, ça veut dire que c'est toi qui risque de saigner ! Surtout, si ça arrive, tu ne paniques pas, et si tu paniques, tu m'appelles. Ce n'est pas dangereux, c'est juste un tantinet embarrassant. Mais bon, l'embarras et moi, ça fait longtemps qu'on se connaît et on est même plutôt proches.

- C'est pas une goutte de sang qui va me faire peur.

-Par contre, ça effraie Rachel, et... et...

- C'est plus compliqué que ça... me dit je à moi même

Ninon-Kaede se tourna vers l'intéressée en souriant.

-Et on va tacher de ne pas t'effrayer, ça a l'air d'être mauvais pour ta ligne.

Je laisser échapper un petit pouffement de rire.

Enfin pas que ta ligne soit mauvaise et qu'elle risque de l'être, c'est...

- C'est repartie ?

- C'est juste une métaphore Rachel tu es parfaite, enfin je veux dire que tu as une très jolie ligne, enfin jolie de la manière que tu es comme tu es et.. .et..

Je regardais Rachel, contemplant mon magnifique échec sur ma mission de silence radio. Le moulin à parole tournait à toute allure. Au moins j'aurais tenté et en plus c'était pas désagréable. Je pensais pas mes lèvres si douce.

- Bref, ne change rien, tu es très bien et mange tant que tu le veux ! He... et si on se levait? Parce que ce n'est pas le tout, mais l'herbe est fraîche et tes fesses, ainsi que les miennes, vont être trempées si on y reste assises. Donc debout !

- Bonne idée.

Et la, il s'était passé quelque chose de magique. Le contrepoids parfait et synchronisé. Ayant l'habitude de contre balancé le poid de ma poitrine avec mon dos, je n'avais pas vraiment perdue ma posture. Donc je contrebalançait... dans le vide ! Non pas que la poitrine de Ninon était vide, il y avait cependant un nette changement dans la force gravitationelle avant et celle de mon dos actuellement. Et tandis que Ninon basculait vers le coté lumineux de la force, en plein sur les fesses, je basculais moi vers le coté sombre, la tête la première, vers l'avant.

On se retrouvait alors devant Rachel Kenobi, qui, j'imaginais, devait nous regarder d'un air désespérée, se demandant ce que l'on pourrait faire de nous... Je n'en savais rien cependant, vu qu'actuellement ma vue était celle d'un joli brin d'herbe qui me grattouillait le nez.

-Mmmmaïlleux ! dis je d'une voix étouffée.

_ Aieuh... Mmrf, comme quoi, la taille du coussin importe peu, ça fait toujours aussi mal...

- Je suis pas d'accord. Tes os pointus font plus mal que les coussins... Et qu'est ce que tu insinue ? Je me relevais lentement mais surement en gardant un équilibre pré-caire entre mes habitudes et la réalité de mon corps d’accueil.

Heeuu .. Je … je … je … C'est pas ce que tu penses mon gentil Général ! Je ne parlais pas de tes fesses !

-Ah ?

Enfin, pas complètement, je parlais de l'herbe ! Elle n'a pas amorti la chute et... et... et... Et tes fesses non plus, mais les miennes ne l'auraient pas plus fait et... et qu'est ce que je voulais dire ?...

- Que j'ai des grosses fesses ?

Oh, pardon, je ne voulais pas insinuer que tu étais... Enfin je veux dire que tu es parfaite, à tel point que je suis plutôt heureuse d'être chez toi. Si si, je t'assure que c'est vrai !

Je relevais juste le sourcil droit, comme Teal'k dans Stargate SG1. C'était Laura qui m'avait fait découvrir ça. C'était trop drôle. J’espérais que Ninon ou Rachel capte la référence. Il parait que c'est très connue.
Indeed:
 

- Oh pardon mon Général... Vous m'accorderiez une danse pour me faire pardonner ? Je promet même de ne pas te saigner dessus. Et si ça ne suffit pas, je referai des cookies !

Je la regardais alors en faisant ma KaedeFace, qui sur une Ninon, rendait encore plus mignon. Comme si son visage décuplait le taux de "Mignon" dans ces expressions.
- Puisqu'il y a des cookies... Avec lesquelles je vais pouvoir m'empiffrer sans prendre un kilos ! -Pourquoi pas ! Le temps que John retrouve ses esprits, on peut du coup en profiter je suppose. Tu es d'accord Rachel ?

-Bon, debout debout debout !

- Oh oui, ça va, ça vient ! T'es pas lourde mais t'as pas de force non plus !

J'attendais alors les recommandations de notre Rachel adorée et l'invitait même à nous rejoindre si la situation le lui permettait.

_________________
Revenir en haut Aller en bas
Voir le profil de l'utilisateur
Contenu sponsorisé




MessageSujet: Re: Halloween Night {Libre}   

Revenir en haut Aller en bas
 
Halloween Night {Libre}
Voir le sujet précédent Voir le sujet suivant Revenir en haut 
Page 1 sur 2Aller à la page : 1, 2  Suivant
 Sujets similaires
-
» eau libre
» Halloween en Italie
» C’est comment l’halloween dans votre pays
» nouvelle poudre libre HD
» Calavera (Halloween)

Permission de ce forum:Vous ne pouvez pas répondre aux sujets dans ce forum
X-men RPG :: Hors Jeu :: Topics Terminés :: L'Institution Charles-Xavier et Alentours-
Sauter vers: